\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610487198:

Variant ID: vg0610487198 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10487198
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.25, others allele: 0.00, population size: 57. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGTGACCCACGTCCACGTGAGTTAGGAGTTGTGTGTTATTATGAGAAATCTTGAGCGGCTTTACTACAAACGCCGTGTTTAGTTCCAAAATAATTCTT[C/T]
AAACTTTCAACTTTTTCATCACATCAGAAATTTCCTACACACAAATTTTCAACTTTTTCATCACATCGTTTCAATTTCAACTAAACTTCTAATTTTACTG

Reverse complement sequence

CAGTAAAATTAGAAGTTTAGTTGAAATTGAAACGATGTGATGAAAAAGTTGAAAATTTGTGTGTAGGAAATTTCTGATGTGATGAAAAAGTTGAAAGTTT[G/A]
AAGAATTATTTTGGAACTAAACACGGCGTTTGTAGTAAAGCCGCTCAAGATTTCTCATAATAACACACAACTCCTAACTCACGTGGACGTGGGTCACCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.40% 23.20% 0.36% 41.96% NA
All Indica  2759 54.80% 18.10% 0.33% 26.75% NA
All Japonica  1512 2.20% 37.10% 0.33% 60.32% NA
Aus  269 16.70% 1.50% 0.37% 81.41% NA
Indica I  595 78.20% 15.10% 0.00% 6.72% NA
Indica II  465 87.10% 3.40% 0.00% 9.46% NA
Indica III  913 30.00% 25.80% 0.44% 43.70% NA
Indica Intermediate  786 46.80% 20.10% 0.64% 32.44% NA
Temperate Japonica  767 2.30% 52.30% 0.52% 44.85% NA
Tropical Japonica  504 1.40% 22.60% 0.00% 75.99% NA
Japonica Intermediate  241 3.70% 19.10% 0.41% 76.76% NA
VI/Aromatic  96 5.20% 6.20% 2.08% 86.46% NA
Intermediate  90 35.60% 30.00% 0.00% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610487198 C -> T LOC_Os06g18020.1 upstream_gene_variant ; 1250.0bp to feature; MODIFIER silent_mutation Average:78.303; most accessible tissue: Zhenshan97 panicle, score: 97.252 N N N N
vg0610487198 C -> T LOC_Os06g18010-LOC_Os06g18020 intergenic_region ; MODIFIER silent_mutation Average:78.303; most accessible tissue: Zhenshan97 panicle, score: 97.252 N N N N
vg0610487198 C -> DEL N N silent_mutation Average:78.303; most accessible tissue: Zhenshan97 panicle, score: 97.252 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0610487198 C T 0.05 0.03 0.03 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610487198 NA 1.89E-09 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 9.55E-08 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 3.65E-06 2.41E-08 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 2.87E-12 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 6.01E-08 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 1.58E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 8.43E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 2.01E-06 2.33E-09 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 3.67E-07 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 1.08E-07 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 4.79E-09 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 2.35E-06 NA mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 2.58E-06 2.94E-09 mr1422 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 2.34E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 1.79E-06 NA mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 3.10E-07 5.83E-09 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 3.19E-07 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 3.12E-10 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 2.83E-10 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 7.68E-06 NA mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 1.32E-06 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 1.42E-12 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 1.81E-09 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 4.51E-09 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 1.62E-10 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 3.35E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 4.32E-07 8.95E-12 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 6.20E-06 2.11E-12 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 3.81E-08 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 1.76E-06 3.30E-10 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 1.45E-06 NA mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610487198 NA 4.00E-10 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251