\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610467785:

Variant ID: vg0610467785 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10467785
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


ATCATATTTTACATTTACATGTAGGAATGAAGTAATGGCTACCACTTTTTTACTTGTTTCTATATGTATGCAGCCATGGCTTTCTTTACTAACCTAGCTG[C/T]
GGTATAGATCCAGCTAGCTTTATACTCACATATTACTGTCTTCCATAAACCTTTCCATTTGCCAGCCAATGTAATGCGATCCTTTTTCTCTATCATGTTT

Reverse complement sequence

AAACATGATAGAGAAAAAGGATCGCATTACATTGGCTGGCAAATGGAAAGGTTTATGGAAGACAGTAATATGTGAGTATAAAGCTAGCTGGATCTATACC[G/A]
CAGCTAGGTTAGTAAAGAAAGCCATGGCTGCATACATATAGAAACAAGTAAAAAAGTGGTAGCCATTACTTCATTCCTACATGTAAATGTAAAATATGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.30% 8.10% 0.40% 58.17% NA
All Indica  2759 11.60% 0.80% 0.47% 87.10% NA
All Japonica  1512 61.40% 23.20% 0.20% 15.15% NA
Aus  269 82.20% 0.70% 0.37% 16.73% NA
Indica I  595 9.20% 1.20% 0.84% 88.74% NA
Indica II  465 1.70% 1.10% 0.43% 96.77% NA
Indica III  913 16.30% 0.20% 0.00% 83.46% NA
Indica Intermediate  786 13.70% 1.10% 0.76% 84.35% NA
Temperate Japonica  767 52.30% 40.80% 0.26% 6.65% NA
Tropical Japonica  504 69.20% 0.40% 0.20% 30.16% NA
Japonica Intermediate  241 74.30% 14.90% 0.00% 10.79% NA
VI/Aromatic  96 86.50% 0.00% 0.00% 13.54% NA
Intermediate  90 25.60% 6.70% 2.22% 65.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610467785 C -> T LOC_Os06g17990.1 downstream_gene_variant ; 4823.0bp to feature; MODIFIER silent_mutation Average:6.107; most accessible tissue: Callus, score: 22.506 N N N N
vg0610467785 C -> T LOC_Os06g18000.1 downstream_gene_variant ; 1514.0bp to feature; MODIFIER silent_mutation Average:6.107; most accessible tissue: Callus, score: 22.506 N N N N
vg0610467785 C -> T LOC_Os06g17990-LOC_Os06g18000 intergenic_region ; MODIFIER silent_mutation Average:6.107; most accessible tissue: Callus, score: 22.506 N N N N
vg0610467785 C -> DEL N N silent_mutation Average:6.107; most accessible tissue: Callus, score: 22.506 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610467785 2.35E-06 6.26E-12 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610467785 NA 1.13E-09 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610467785 NA 1.76E-07 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610467785 NA 9.94E-11 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610467785 NA 1.52E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610467785 NA 3.78E-07 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610467785 2.61E-06 NA mr1877 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610467785 3.10E-06 4.85E-09 mr1877 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610467785 NA 1.92E-10 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610467785 NA 6.63E-09 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610467785 5.46E-06 7.51E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610467785 NA 2.87E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610467785 NA 7.70E-08 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251