Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0610465783:

Variant ID: vg0610465783 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10465783
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.56, A: 0.44, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTCGGTTTTTAAGTTTGTTTGCTTTTGGAAATACACAACCGTATTTGATTCGGTTTTTAAGATCGTTCACTTTTGATAATATAGAAGGAATCATATAA[A/G]
AAATTTGTTTAAAAAAACTCGCATGCTAACTTGAGATGACCGAACTCCTAAATACAGCGCATGATTTTCTAAAAATATATAAAGTGAACTCTTACAGTGA

Reverse complement sequence

TCACTGTAAGAGTTCACTTTATATATTTTTAGAAAATCATGCGCTGTATTTAGGAGTTCGGTCATCTCAAGTTAGCATGCGAGTTTTTTTAAACAAATTT[T/C]
TTATATGATTCCTTCTATATTATCAAAAGTGAACGATCTTAAAAACCGAATCAAATACGGTTGTGTATTTCCAAAAGCAAACAAACTTAAAAACCGACAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.50%	10.70%	1.06%	56.81%	NA
All Indica	2759	11.20%	2.50%	1.52%	84.78%	NA
All Japonica	1512	56.30%	28.10%	0.33%	15.21%	NA
Aus	269	82.50%	0.70%	0.00%	16.73%	NA
Indica I	595	9.40%	1.20%	2.18%	87.23%	NA
Indica II	465	1.70%	1.30%	1.51%	95.48%	NA
Indica III	913	15.60%	3.20%	0.88%	80.39%	NA
Indica Intermediate	786	13.00%	3.60%	1.78%	81.68%	NA
Temperate Japonica	767	42.20%	50.60%	0.26%	6.91%	NA
Tropical Japonica	504	69.60%	0.20%	0.20%	29.96%	NA
Japonica Intermediate	241	73.40%	14.90%	0.83%	10.79%	NA
VI/Aromatic	96	86.50%	0.00%	0.00%	13.54%	NA
Intermediate	90	24.40%	7.80%	3.33%	64.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610465783	A -> G	LOC_Os06g17990.1	downstream_gene_variant ; 2821.0bp to feature; MODIFIER	silent_mutation	Average:11.729; most accessible tissue: Callus, score: 73.883	N	N	N	N
vg0610465783	A -> G	LOC_Os06g18000.1	downstream_gene_variant ; 3516.0bp to feature; MODIFIER	silent_mutation	Average:11.729; most accessible tissue: Callus, score: 73.883	N	N	N	N
vg0610465783	A -> G	LOC_Os06g17990-LOC_Os06g18000	intergenic_region ; MODIFIER	silent_mutation	Average:11.729; most accessible tissue: Callus, score: 73.883	N	N	N	N
vg0610465783	A -> DEL	N	N	silent_mutation	Average:11.729; most accessible tissue: Callus, score: 73.883	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610465783	1.04E-06	NA	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610465783	9.06E-06	NA	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610465783	2.57E-06	NA	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610465783	6.44E-07	NA	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610465783	6.39E-07	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610465783	2.15E-08	NA	mr1211_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610465783	1.64E-06	NA	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610465783	NA	5.48E-06	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251