\
| Variant ID: vg0610459123 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 10459123 |
| Reference Allele: T | Alternative Allele: C,TGA,TCGTGA,TTGA |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCTCGGCCGATTCTAGTGATAACTGGAATTCTTGGTCATAATATATGTTCAATTACGGGTGGACAGGAAGGTTATGGCTCGTTAGCTCGCTCGACTCGGC[T/C,TGA,TCGTGA,TTGA]
CTTTTAAATTTCGTAACGAGCCGAGCTGGCGCTAAAAGCTCGTCAGAGATAACAAGCTAGCTTGTGAGCTGCTCGCGAGCCTTAACGAGCTAGCACTCTA
TAGAGTGCTAGCTCGTTAAGGCTCGCGAGCAGCTCACAAGCTAGCTTGTTATCTCTGACGAGCTTTTAGCGCCAGCTCGGCTCGTTACGAAATTTAAAAG[A/G,TCA,TCACGA,TCAA]
GCCGAGTCGAGCGAGCTAACGAGCCATAACCTTCCTGTCCACCCGTAATTGAACATATATTATGACCAAGAATTCCAGTTATCACTAGAATCGGCCGAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.90% | 33.00% | 1.38% | 4.36% | TCGTGA: 0.19%; TTGA: 0.11%; TGA: 0.08% |
| All Indica | 2759 | 38.10% | 53.40% | 1.38% | 6.52% | TCGTGA: 0.33%; TTGA: 0.18%; TGA: 0.14% |
| All Japonica | 1512 | 96.00% | 1.00% | 1.52% | 1.46% | NA |
| Aus | 269 | 84.00% | 16.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 22.20% | 68.20% | 1.34% | 7.90% | TCGTGA: 0.34% |
| Indica II | 465 | 13.50% | 69.50% | 1.72% | 14.62% | TCGTGA: 0.65% |
| Indica III | 913 | 53.80% | 42.10% | 0.88% | 2.30% | TTGA: 0.55%; TCGTGA: 0.33%; TGA: 0.11% |
| Indica Intermediate | 786 | 46.40% | 45.70% | 1.78% | 5.60% | TGA: 0.38%; TCGTGA: 0.13% |
| Temperate Japonica | 767 | 97.70% | 1.00% | 0.52% | 0.78% | NA |
| Tropical Japonica | 504 | 93.10% | 0.40% | 3.37% | 3.17% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 27.80% | 4.44% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610459123 | T -> TCGTGA | LOC_Os06g17980.1 | upstream_gene_variant ; 3880.0bp to feature; MODIFIER | silent_mutation | Average:67.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0610459123 | T -> TCGTGA | LOC_Os06g17990.1 | upstream_gene_variant ; 3462.0bp to feature; MODIFIER | silent_mutation | Average:67.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0610459123 | T -> TCGTGA | LOC_Os06g17980-LOC_Os06g17990 | intergenic_region ; MODIFIER | silent_mutation | Average:67.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0610459123 | T -> TGA | LOC_Os06g17980.1 | upstream_gene_variant ; 3880.0bp to feature; MODIFIER | silent_mutation | Average:67.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0610459123 | T -> TGA | LOC_Os06g17990.1 | upstream_gene_variant ; 3462.0bp to feature; MODIFIER | silent_mutation | Average:67.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0610459123 | T -> TGA | LOC_Os06g17980-LOC_Os06g17990 | intergenic_region ; MODIFIER | silent_mutation | Average:67.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0610459123 | T -> DEL | N | N | silent_mutation | Average:67.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0610459123 | T -> C | LOC_Os06g17980.1 | upstream_gene_variant ; 3879.0bp to feature; MODIFIER | silent_mutation | Average:67.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0610459123 | T -> C | LOC_Os06g17990.1 | upstream_gene_variant ; 3463.0bp to feature; MODIFIER | silent_mutation | Average:67.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0610459123 | T -> C | LOC_Os06g17980-LOC_Os06g17990 | intergenic_region ; MODIFIER | silent_mutation | Average:67.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0610459123 | T -> TTGA | LOC_Os06g17980.1 | upstream_gene_variant ; 3880.0bp to feature; MODIFIER | silent_mutation | Average:67.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0610459123 | T -> TTGA | LOC_Os06g17990.1 | upstream_gene_variant ; 3462.0bp to feature; MODIFIER | silent_mutation | Average:67.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0610459123 | T -> TTGA | LOC_Os06g17980-LOC_Os06g17990 | intergenic_region ; MODIFIER | silent_mutation | Average:67.727; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610459123 | 4.27E-31 | 5.11E-103 | mr1065 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.98E-26 | 2.14E-42 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 5.00E-22 | 1.52E-71 | mr1067 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 3.23E-18 | 7.59E-26 | mr1067 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.73E-27 | 1.15E-89 | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 3.28E-21 | 1.60E-30 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.55E-20 | 8.36E-71 | mr1078 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.88E-18 | 1.35E-24 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | NA | 3.12E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 3.35E-27 | 4.07E-82 | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.51E-23 | 7.07E-31 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 7.39E-20 | 5.95E-70 | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.25E-11 | 3.89E-14 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 3.30E-30 | 5.62E-92 | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.60E-27 | 7.26E-49 | mr1091 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.85E-16 | 7.08E-64 | mr1094 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 4.77E-13 | 8.12E-26 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.80E-21 | 2.13E-81 | mr1096 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 4.63E-18 | 3.64E-30 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | NA | 7.49E-06 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 5.22E-24 | 6.43E-80 | mr1108 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.62E-24 | 2.62E-38 | mr1108 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 3.83E-17 | 1.42E-68 | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.05E-16 | 2.31E-31 | mr1110 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 3.70E-16 | 9.34E-66 | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.81E-12 | 6.02E-20 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.13E-20 | 5.97E-78 | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.96E-20 | 2.09E-36 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 6.51E-18 | 2.42E-68 | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 5.60E-16 | 4.57E-23 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 3.98E-19 | 4.02E-70 | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 7.43E-17 | 1.51E-25 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.23E-15 | 7.82E-59 | mr1200 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 3.24E-13 | 9.68E-18 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 3.56E-14 | 2.68E-53 | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.86E-08 | 2.38E-08 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | NA | 3.56E-08 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.48E-06 | 7.33E-09 | mr1215 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 9.00E-15 | 3.73E-32 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 3.43E-12 | 1.14E-18 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | NA | 5.11E-08 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.39E-15 | 1.63E-45 | mr1221 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.10E-12 | 1.80E-17 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 4.32E-28 | 5.15E-90 | mr1234 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 8.82E-23 | 1.71E-36 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 8.17E-12 | 7.68E-48 | mr1237 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.53E-09 | 1.94E-17 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.40E-11 | 8.49E-33 | mr1244 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.04E-08 | 2.04E-16 | mr1244 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | NA | 8.65E-21 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 3.85E-06 | 3.95E-10 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 4.67E-18 | 1.15E-66 | mr1526 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.49E-13 | 4.99E-20 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.91E-07 | 3.44E-22 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.91E-09 | 3.71E-14 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | NA | 1.78E-10 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 6.14E-14 | 2.16E-51 | mr1877 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 5.72E-10 | 2.91E-19 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.22E-37 | 1.00E-120 | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 5.05E-34 | 6.68E-54 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.01E-23 | 2.98E-83 | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.54E-20 | 4.23E-28 | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.90E-29 | 1.73E-101 | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.25E-23 | 3.30E-34 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.60E-28 | 4.23E-90 | mr1078_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.96E-28 | 6.01E-32 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.31E-33 | 8.86E-93 | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 9.48E-29 | 1.22E-34 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 6.55E-25 | 6.37E-79 | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 8.75E-16 | 1.80E-16 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 9.77E-32 | 1.02E-103 | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 4.84E-29 | 6.67E-53 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 3.42E-17 | 1.46E-73 | mr1094_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.35E-14 | 3.63E-27 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 3.94E-21 | 6.33E-85 | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.01E-18 | 1.36E-31 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 5.58E-27 | 4.01E-90 | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.51E-26 | 4.06E-38 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.77E-23 | 7.07E-79 | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.35E-23 | 1.47E-37 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.57E-21 | 1.68E-75 | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.79E-19 | 9.62E-27 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 5.21E-26 | 6.79E-101 | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 5.92E-27 | 5.93E-47 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 8.20E-18 | 6.13E-71 | mr1121_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.16E-18 | 3.99E-26 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.88E-19 | 2.43E-73 | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 7.91E-17 | 3.30E-25 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 3.72E-16 | 3.81E-68 | mr1200_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.83E-14 | 8.86E-21 | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 6.83E-18 | 8.64E-62 | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 6.66E-12 | 5.26E-12 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | NA | 1.07E-11 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | NA | 1.41E-09 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.04E-14 | 1.12E-44 | mr1218_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 5.40E-12 | 1.18E-26 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | NA | 2.81E-11 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | NA | 6.85E-08 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.81E-19 | 2.74E-66 | mr1221_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.66E-15 | 2.43E-30 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.62E-30 | 6.41E-101 | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.33E-28 | 2.39E-42 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | NA | 1.94E-07 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.13E-11 | 1.21E-36 | mr1244_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 5.87E-10 | 2.71E-16 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | NA | 1.48E-06 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 5.09E-06 | 5.16E-28 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 4.29E-06 | 4.17E-12 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | NA | 1.20E-13 | mr1454_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | NA | 4.39E-06 | mr1454_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.52E-27 | 9.86E-82 | mr1526_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.69E-23 | 6.50E-29 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 2.00E-07 | 1.79E-19 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 8.34E-08 | 1.39E-15 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 3.80E-07 | 1.97E-19 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 4.51E-09 | 1.06E-18 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 1.06E-11 | 1.41E-42 | mr1877_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | 4.38E-07 | 1.58E-13 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610459123 | NA | 6.31E-07 | mr1954_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |