\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610455473:

Variant ID: vg0610455473 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10455473
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, T: 0.36, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AGCGGGTTCCTCCTCCTGTGGTCGCGAGCAGCGGCGTTTGGGAGACGACGAGCGAACCGGCGTCGAGGCAGCGCGGGGGAGATGGCAAGGGAGCCGGCGT[T/G]
GAGGGAGACGGCCGGGCCGCGCGCACTGTGCTCCTCCCTGTCGTCCAAAAGGGATGAAGGGCAAAATAGTAAAATCGCTCTATCCTTAATTTTGTCCATG

Reverse complement sequence

CATGGACAAAATTAAGGATAGAGCGATTTTACTATTTTGCCCTTCATCCCTTTTGGACGACAGGGAGGAGCACAGTGCGCGCGGCCCGGCCGTCTCCCTC[A/C]
ACGCCGGCTCCCTTGCCATCTCCCCCGCGCTGCCTCGACGCCGGTTCGCTCGTCGTCTCCCAAACGCCGCTGCTCGCGACCACAGGAGGAGGAACCCGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 9.40% 0.47% 36.03% NA
All Indica  2759 40.30% 0.50% 0.69% 58.43% NA
All Japonica  1512 71.50% 27.20% 0.00% 1.26% NA
Aus  269 82.90% 1.90% 0.74% 14.50% NA
Indica I  595 22.70% 1.20% 1.51% 74.62% NA
Indica II  465 14.40% 0.40% 1.51% 83.66% NA
Indica III  913 56.00% 0.10% 0.00% 43.92% NA
Indica Intermediate  786 50.90% 0.60% 0.38% 48.09% NA
Temperate Japonica  767 49.80% 48.90% 0.00% 1.30% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 81.70% 15.40% 0.00% 2.90% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 57.80% 11.10% 1.11% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610455473 T -> G LOC_Os06g17980.1 upstream_gene_variant ; 229.0bp to feature; MODIFIER silent_mutation Average:40.059; most accessible tissue: Callus, score: 67.857 N N N N
vg0610455473 T -> G LOC_Os06g17970.1 downstream_gene_variant ; 4321.0bp to feature; MODIFIER silent_mutation Average:40.059; most accessible tissue: Callus, score: 67.857 N N N N
vg0610455473 T -> G LOC_Os06g17980-LOC_Os06g17990 intergenic_region ; MODIFIER silent_mutation Average:40.059; most accessible tissue: Callus, score: 67.857 N N N N
vg0610455473 T -> DEL N N silent_mutation Average:40.059; most accessible tissue: Callus, score: 67.857 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610455473 4.09E-09 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455473 1.55E-07 5.55E-11 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455473 NA 3.42E-07 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455473 NA 3.51E-13 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455473 NA 1.39E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455473 NA 5.60E-14 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455473 6.63E-14 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455473 3.18E-12 8.04E-21 mr1087_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455473 NA 1.34E-07 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455473 NA 1.56E-06 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455473 NA 1.68E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455473 NA 2.90E-12 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455473 NA 9.81E-07 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251