Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0610453711:

Variant ID: vg0610453711 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10453711
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGTTTTGATTTTATAAGGTGCTGATGACAACAAAATGAGAGATGGCGGGACAGGTTGACAACTAGACAGGTGGAAAATAAGTAAGAAGATGATAGTTGC[T/A]
ATCGGAGAGTGAGCAGAGGGGTGGCAAATGAATAAGGTAGTGGTGACAACTTCGACAAACTATGAAAATAAAACCTTGACGCGATTTTGTAAGGTACCTA

Reverse complement sequence

TAGGTACCTTACAAAATCGCGTCAAGGTTTTATTTTCATAGTTTGTCGAAGTTGTCACCACTACCTTATTCATTTGCCACCCCTCTGCTCACTCTCCGAT[A/T]
GCAACTATCATCTTCTTACTTATTTTCCACCTGTCTAGTTGTCAACCTGTCCCGCCATCTCTCATTTTGTTGTCATCAGCACCTTATAAAATCAAAACTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.20%	9.80%	2.73%	29.20%	NA
All Indica	2759	49.60%	0.80%	1.78%	47.81%	NA
All Japonica	1512	77.40%	18.40%	3.17%	1.06%	NA
Aus	269	28.60%	54.60%	9.67%	7.06%	NA
Indica I	595	28.70%	0.00%	2.86%	68.40%	NA
Indica II	465	22.20%	0.60%	3.23%	73.98%	NA
Indica III	913	72.00%	0.30%	0.77%	26.94%	NA
Indica Intermediate	786	55.70%	2.00%	1.27%	40.97%	NA
Temperate Japonica	767	93.10%	2.50%	3.13%	1.30%	NA
Tropical Japonica	504	51.00%	45.60%	3.17%	0.20%	NA
Japonica Intermediate	241	82.60%	12.00%	3.32%	2.07%	NA
VI/Aromatic	96	81.20%	12.50%	2.08%	4.17%	NA
Intermediate	90	64.40%	6.70%	4.44%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610453711	T -> A	LOC_Os06g17970.1	downstream_gene_variant ; 2559.0bp to feature; MODIFIER	silent_mutation	Average:13.122; most accessible tissue: Callus, score: 78.548	N	N	N	N
vg0610453711	T -> A	LOC_Os06g17980.1	downstream_gene_variant ; 1042.0bp to feature; MODIFIER	silent_mutation	Average:13.122; most accessible tissue: Callus, score: 78.548	N	N	N	N
vg0610453711	T -> A	LOC_Os06g17970-LOC_Os06g17980	intergenic_region ; MODIFIER	silent_mutation	Average:13.122; most accessible tissue: Callus, score: 78.548	N	N	N	N
vg0610453711	T -> DEL	N	N	silent_mutation	Average:13.122; most accessible tissue: Callus, score: 78.548	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610453711	1.96E-06	NA	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610453711	3.59E-06	NA	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610453711	NA	1.54E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610453711	NA	2.87E-13	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610453711	2.11E-08	NA	mr1090_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610453711	2.42E-07	NA	mr1090_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610453711	NA	6.30E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251