\
| Variant ID: vg0610453680 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10453680 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAATAATAAAAAGGAACTCCAACTAGGATAAGAGTTTTGATTTTATAAGGTGCTGATGACAACAAAATGAGAGATGGCGGGACAGGTTGACAACTAGACA[G/T,A]
GTGGAAAATAAGTAAGAAGATGATAGTTGCTATCGGAGAGTGAGCAGAGGGGTGGCAAATGAATAAGGTAGTGGTGACAACTTCGACAAACTATGAAAAT
ATTTTCATAGTTTGTCGAAGTTGTCACCACTACCTTATTCATTTGCCACCCCTCTGCTCACTCTCCGATAGCAACTATCATCTTCTTACTTATTTTCCAC[C/A,T]
TGTCTAGTTGTCAACCTGTCCCGCCATCTCTCATTTTGTTGTCATCAGCACCTTATAAAATCAAAACTCTTATCCTAGTTGGAGTTCCTTTTTATTATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.50% | 4.00% | 3.00% | 35.46% | T: 0.04% |
| All Indica | 2759 | 35.80% | 5.40% | 4.39% | 54.44% | T: 0.04% |
| All Japonica | 1512 | 91.70% | 1.80% | 1.19% | 5.29% | NA |
| Aus | 269 | 79.20% | 0.40% | 0.00% | 20.07% | T: 0.37% |
| Indica I | 595 | 25.40% | 0.00% | 3.53% | 71.09% | NA |
| Indica II | 465 | 8.00% | 9.20% | 3.87% | 78.92% | NA |
| Indica III | 913 | 46.50% | 8.70% | 5.59% | 39.21% | NA |
| Indica Intermediate | 786 | 47.60% | 3.30% | 3.94% | 45.04% | T: 0.13% |
| Temperate Japonica | 767 | 95.60% | 2.20% | 0.26% | 1.96% | NA |
| Tropical Japonica | 504 | 86.70% | 0.40% | 2.58% | 10.32% | NA |
| Japonica Intermediate | 241 | 90.00% | 3.30% | 1.24% | 5.39% | NA |
| VI/Aromatic | 96 | 75.00% | 8.30% | 1.04% | 15.62% | NA |
| Intermediate | 90 | 65.60% | 4.40% | 2.22% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610453680 | G -> T | LOC_Os06g17970.1 | downstream_gene_variant ; 2528.0bp to feature; MODIFIER | silent_mutation | Average:13.065; most accessible tissue: Callus, score: 78.548 | N | N | N | N |
| vg0610453680 | G -> T | LOC_Os06g17980.1 | downstream_gene_variant ; 1073.0bp to feature; MODIFIER | silent_mutation | Average:13.065; most accessible tissue: Callus, score: 78.548 | N | N | N | N |
| vg0610453680 | G -> T | LOC_Os06g17970-LOC_Os06g17980 | intergenic_region ; MODIFIER | silent_mutation | Average:13.065; most accessible tissue: Callus, score: 78.548 | N | N | N | N |
| vg0610453680 | G -> A | LOC_Os06g17970.1 | downstream_gene_variant ; 2528.0bp to feature; MODIFIER | silent_mutation | Average:13.065; most accessible tissue: Callus, score: 78.548 | N | N | N | N |
| vg0610453680 | G -> A | LOC_Os06g17980.1 | downstream_gene_variant ; 1073.0bp to feature; MODIFIER | silent_mutation | Average:13.065; most accessible tissue: Callus, score: 78.548 | N | N | N | N |
| vg0610453680 | G -> A | LOC_Os06g17970-LOC_Os06g17980 | intergenic_region ; MODIFIER | silent_mutation | Average:13.065; most accessible tissue: Callus, score: 78.548 | N | N | N | N |
| vg0610453680 | G -> DEL | N | N | silent_mutation | Average:13.065; most accessible tissue: Callus, score: 78.548 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610453680 | 1.47E-07 | 1.14E-10 | mr1695 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610453680 | 9.28E-09 | 1.14E-12 | mr1695_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |