\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610444948:

Variant ID: vg0610444948 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10444948
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


CCAGGCCCATCCTGCAGCTGCGACGACGACGAAGACTTGCGTCGGAGACTTGGAATCAAGTCACGGCCGGCAAAGCGCATGCCAAAATATGCTACGACGA[T/C]
GATGACGACGATTCCGTCAGTCACGGCGCGCCTGAGGGCCCATGTTGCCAGCCGACGCCGTCCACCCATTCCTTACTTCCCCCTTGTTGGTTCCTCAGCC

Reverse complement sequence

GGCTGAGGAACCAACAAGGGGGAAGTAAGGAATGGGTGGACGGCGTCGGCTGGCAACATGGGCCCTCAGGCGCGCCGTGACTGACGGAATCGTCGTCATC[A/G]
TCGTCGTAGCATATTTTGGCATGCGCTTTGCCGGCCGTGACTTGATTCCAAGTCTCCGACGCAAGTCTTCGTCGTCGTCGCAGCTGCAGGATGGGCCTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.30% 30.50% 1.59% 34.57% NA
All Indica  2759 4.50% 36.70% 2.46% 56.29% NA
All Japonica  1512 73.80% 24.90% 0.26% 0.99% NA
Aus  269 83.30% 3.00% 0.00% 13.75% NA
Indica I  595 9.20% 16.00% 1.01% 73.78% NA
Indica II  465 1.70% 13.30% 2.15% 82.80% NA
Indica III  913 1.60% 54.50% 4.82% 38.99% NA
Indica Intermediate  786 6.00% 45.50% 1.02% 47.46% NA
Temperate Japonica  767 79.30% 19.40% 0.13% 1.17% NA
Tropical Japonica  504 62.70% 36.90% 0.00% 0.40% NA
Japonica Intermediate  241 79.70% 17.40% 1.24% 1.66% NA
VI/Aromatic  96 80.20% 15.60% 2.08% 2.08% NA
Intermediate  90 36.70% 32.20% 1.11% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610444948 T -> C LOC_Os06g17960.1 upstream_gene_variant ; 1901.0bp to feature; MODIFIER silent_mutation Average:23.009; most accessible tissue: Callus, score: 96.725 N N N N
vg0610444948 T -> C LOC_Os06g17970.1 upstream_gene_variant ; 104.0bp to feature; MODIFIER silent_mutation Average:23.009; most accessible tissue: Callus, score: 96.725 N N N N
vg0610444948 T -> C LOC_Os06g17950.1 downstream_gene_variant ; 3041.0bp to feature; MODIFIER silent_mutation Average:23.009; most accessible tissue: Callus, score: 96.725 N N N N
vg0610444948 T -> C LOC_Os06g17960-LOC_Os06g17970 intergenic_region ; MODIFIER silent_mutation Average:23.009; most accessible tissue: Callus, score: 96.725 N N N N
vg0610444948 T -> DEL N N silent_mutation Average:23.009; most accessible tissue: Callus, score: 96.725 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610444948 1.44E-07 2.74E-12 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 4.26E-10 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 3.86E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 1.79E-08 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 8.76E-08 7.39E-15 mr1091 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 4.24E-11 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 9.82E-11 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 3.49E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 8.69E-11 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 3.87E-09 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 1.79E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 5.64E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 8.88E-07 1.03E-09 mr1218 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 1.92E-06 4.32E-10 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 1.77E-07 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 2.25E-07 2.84E-13 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 2.87E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 2.95E-07 1.80E-09 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 1.57E-06 2.68E-14 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 7.77E-09 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 1.64E-09 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 2.77E-12 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 1.04E-10 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 5.03E-08 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 5.28E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 4.08E-12 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 1.72E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 1.22E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 1.58E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 9.89E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610444948 NA 6.86E-07 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251