\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610443754:

Variant ID: vg0610443754 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10443754
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.55, C: 0.45, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTCTTCACTTTTTTTTTTCTGTATTTTGGTTTTCTATCCTCTGTGACTACACATTTGAATCGAACATGCTCTGTCTCTGCTCGGAATACTTATTATT[C/G]
GGCCAACATAAATGCATAGGGCCATTTGGAATGCGCACTTAAAGGGTGTGTTTAGTTCTTGAAAAAAAGTTAGAAGTTTATGTGTGTAGGAAAGTTTTCG

Reverse complement sequence

CGAAAACTTTCCTACACACATAAACTTCTAACTTTTTTTCAAGAACTAAACACACCCTTTAAGTGCGCATTCCAAATGGCCCTATGCATTTATGTTGGCC[G/C]
AATAATAAGTATTCCGAGCAGAGACAGAGCATGTTCGATTCAAATGTGTAGTCACAGAGGATAGAAAACCAAAATACAGAAAAAAAAAAGTGAAGAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 6.80% 1.40% 33.83% NA
All Indica  2759 35.90% 6.70% 2.32% 55.09% NA
All Japonica  1512 91.30% 7.70% 0.00% 0.99% NA
Aus  269 83.60% 2.60% 0.00% 13.75% NA
Indica I  595 26.10% 0.30% 2.52% 71.09% NA
Indica II  465 8.60% 8.80% 3.01% 79.57% NA
Indica III  913 47.30% 10.00% 2.74% 39.98% NA
Indica Intermediate  786 46.30% 6.40% 1.27% 46.06% NA
Temperate Japonica  767 85.10% 13.80% 0.00% 1.04% NA
Tropical Japonica  504 99.20% 0.40% 0.00% 0.40% NA
Japonica Intermediate  241 94.60% 3.30% 0.00% 2.07% NA
VI/Aromatic  96 87.50% 8.30% 0.00% 4.17% NA
Intermediate  90 66.70% 5.60% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610443754 C -> G LOC_Os06g17960.1 upstream_gene_variant ; 707.0bp to feature; MODIFIER silent_mutation Average:12.804; most accessible tissue: Callus, score: 71.167 N N N N
vg0610443754 C -> G LOC_Os06g17970.1 upstream_gene_variant ; 1298.0bp to feature; MODIFIER silent_mutation Average:12.804; most accessible tissue: Callus, score: 71.167 N N N N
vg0610443754 C -> G LOC_Os06g17950.1 downstream_gene_variant ; 1847.0bp to feature; MODIFIER silent_mutation Average:12.804; most accessible tissue: Callus, score: 71.167 N N N N
vg0610443754 C -> G LOC_Os06g17960-LOC_Os06g17970 intergenic_region ; MODIFIER silent_mutation Average:12.804; most accessible tissue: Callus, score: 71.167 N N N N
vg0610443754 C -> DEL N N silent_mutation Average:12.804; most accessible tissue: Callus, score: 71.167 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610443754 6.72E-08 NA mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610443754 2.33E-06 NA mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610443754 2.24E-07 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610443754 3.60E-08 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610443754 1.59E-07 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610443754 3.00E-06 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610443754 1.65E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610443754 5.68E-07 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610443754 4.61E-06 NA mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610443754 6.41E-08 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610443754 2.39E-07 NA mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610443754 6.61E-06 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610443754 1.07E-06 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610443754 1.35E-08 NA mr1695_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610443754 3.45E-06 NA mr1971_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251