Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610442617:

Variant ID: vg0610442617 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10442617
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

AATTTTTTCTACAGGACACTGTTATTATGTGGTTTTAGCCATAGGACACCGCCCAAACTCATTTTTGGAGAAAAACACTCCATAATAAACGTGGTAATTT[A/G]
CCAATGGACACCATGCCGATTAAAATAATGATTTCCGATTGAGGAGGAGAGAGAAATCGCGTGAAATGTCAAAAATGCCCTTGGGCCCACATGTCAGCTC

Reverse complement sequence

GAGCTGACATGTGGGCCCAAGGGCATTTTTGACATTTCACGCGATTTCTCTCTCCTCCTCAATCGGAAATCATTATTTTAATCGGCATGGTGTCCATTGG[T/C]
AAATTACCACGTTTATTATGGAGTGTTTTTCTCCAAAAATGAGTTTGGGCGGTGTCCTATGGCTAAAACCACATAATAACAGTGTCCTGTAGAAAAAATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.90%	13.20%	0.61%	35.32%	NA
All Indica	2759	23.90%	17.70%	1.01%	57.45%	NA
All Japonica	1512	91.40%	7.50%	0.00%	1.06%	NA
Aus	269	83.60%	2.60%	0.00%	13.75%	NA
Indica I	595	22.20%	3.50%	1.01%	73.28%	NA
Indica II	465	5.40%	10.50%	2.15%	81.94%	NA
Indica III	913	26.50%	29.90%	0.22%	43.37%	NA
Indica Intermediate	786	33.10%	18.30%	1.27%	47.33%	NA
Temperate Japonica	767	85.30%	13.60%	0.00%	1.17%	NA
Tropical Japonica	504	99.20%	0.40%	0.00%	0.40%	NA
Japonica Intermediate	241	94.60%	3.30%	0.00%	2.07%	NA
VI/Aromatic	96	87.50%	8.30%	0.00%	4.17%	NA
Intermediate	90	62.20%	6.70%	1.11%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610442617	A -> G	LOC_Os06g17970.1	upstream_gene_variant ; 2435.0bp to feature; MODIFIER	silent_mutation	Average:14.193; most accessible tissue: Callus, score: 35.276	N	N	N	N
vg0610442617	A -> G	LOC_Os06g17950.1	downstream_gene_variant ; 710.0bp to feature; MODIFIER	silent_mutation	Average:14.193; most accessible tissue: Callus, score: 35.276	N	N	N	N
vg0610442617	A -> G	LOC_Os06g17960.1	downstream_gene_variant ; 20.0bp to feature; MODIFIER	silent_mutation	Average:14.193; most accessible tissue: Callus, score: 35.276	N	N	N	N
vg0610442617	A -> G	LOC_Os06g17950-LOC_Os06g17960	intergenic_region ; MODIFIER	silent_mutation	Average:14.193; most accessible tissue: Callus, score: 35.276	N	N	N	N
vg0610442617	A -> DEL	N	N	silent_mutation	Average:14.193; most accessible tissue: Callus, score: 35.276	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610442617	4.52E-06	3.07E-07	mr1233	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	3.56E-06	NA	mr1496	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	4.10E-06	NA	mr1065_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	5.59E-06	NA	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	NA	1.83E-09	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	3.42E-07	NA	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	9.21E-07	3.54E-11	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	NA	6.75E-09	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	1.65E-06	NA	mr1091_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	1.07E-06	NA	mr1096_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	NA	1.49E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	2.55E-06	NA	mr1111_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	NA	1.99E-06	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	NA	1.60E-07	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	1.32E-06	NA	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	NA	7.13E-07	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617	2.92E-06	NA	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251