\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610442617:

Variant ID: vg0610442617 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10442617
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTTTTCTACAGGACACTGTTATTATGTGGTTTTAGCCATAGGACACCGCCCAAACTCATTTTTGGAGAAAAACACTCCATAATAAACGTGGTAATTT[A/G]
CCAATGGACACCATGCCGATTAAAATAATGATTTCCGATTGAGGAGGAGAGAGAAATCGCGTGAAATGTCAAAAATGCCCTTGGGCCCACATGTCAGCTC

Reverse complement sequence

GAGCTGACATGTGGGCCCAAGGGCATTTTTGACATTTCACGCGATTTCTCTCTCCTCCTCAATCGGAAATCATTATTTTAATCGGCATGGTGTCCATTGG[T/C]
AAATTACCACGTTTATTATGGAGTGTTTTTCTCCAAAAATGAGTTTGGGCGGTGTCCTATGGCTAAAACCACATAATAACAGTGTCCTGTAGAAAAAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 13.20% 0.61% 35.32% NA
All Indica  2759 23.90% 17.70% 1.01% 57.45% NA
All Japonica  1512 91.40% 7.50% 0.00% 1.06% NA
Aus  269 83.60% 2.60% 0.00% 13.75% NA
Indica I  595 22.20% 3.50% 1.01% 73.28% NA
Indica II  465 5.40% 10.50% 2.15% 81.94% NA
Indica III  913 26.50% 29.90% 0.22% 43.37% NA
Indica Intermediate  786 33.10% 18.30% 1.27% 47.33% NA
Temperate Japonica  767 85.30% 13.60% 0.00% 1.17% NA
Tropical Japonica  504 99.20% 0.40% 0.00% 0.40% NA
Japonica Intermediate  241 94.60% 3.30% 0.00% 2.07% NA
VI/Aromatic  96 87.50% 8.30% 0.00% 4.17% NA
Intermediate  90 62.20% 6.70% 1.11% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610442617 A -> G LOC_Os06g17970.1 upstream_gene_variant ; 2435.0bp to feature; MODIFIER silent_mutation Average:14.193; most accessible tissue: Callus, score: 35.276 N N N N
vg0610442617 A -> G LOC_Os06g17950.1 downstream_gene_variant ; 710.0bp to feature; MODIFIER silent_mutation Average:14.193; most accessible tissue: Callus, score: 35.276 N N N N
vg0610442617 A -> G LOC_Os06g17960.1 downstream_gene_variant ; 20.0bp to feature; MODIFIER silent_mutation Average:14.193; most accessible tissue: Callus, score: 35.276 N N N N
vg0610442617 A -> G LOC_Os06g17950-LOC_Os06g17960 intergenic_region ; MODIFIER silent_mutation Average:14.193; most accessible tissue: Callus, score: 35.276 N N N N
vg0610442617 A -> DEL N N silent_mutation Average:14.193; most accessible tissue: Callus, score: 35.276 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610442617 4.52E-06 3.07E-07 mr1233 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 3.56E-06 NA mr1496 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 4.10E-06 NA mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 5.59E-06 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 NA 1.83E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 3.42E-07 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 9.21E-07 3.54E-11 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 NA 6.75E-09 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 1.65E-06 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 1.07E-06 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 NA 1.49E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 2.55E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 NA 1.99E-06 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 NA 1.60E-07 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 1.32E-06 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 NA 7.13E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610442617 2.92E-06 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251