\
| Variant ID: vg0610442142 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10442142 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, G: 0.43, others allele: 0.00, population size: 81. )
TGACAAGAAGACGTAGGAGCAGGGTGGTTCATTGCTCATTGAGGAGGTACTGATAGGTACAAAAATTTGAGATTTGCTCCGGTATAGCAAAAAGTATCTC[G/A]
AGTTATGGGTACCTCACGGTACCAAATCGTTTACGATTGTTAGATCTAGCGTGAGGTATCGGTATCTCAAGGACTCGATGTACTTTTTGTTAGACCGGAG
CTCCGGTCTAACAAAAAGTACATCGAGTCCTTGAGATACCGATACCTCACGCTAGATCTAACAATCGTAAACGATTTGGTACCGTGAGGTACCCATAACT[C/T]
GAGATACTTTTTGCTATACCGGAGCAAATCTCAAATTTTTGTACCTATCAGTACCTCCTCAATGAGCAATGAACCACCCTGCTCCTACGTCTTCTTGTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.70% | 8.80% | 0.99% | 34.55% | NA |
| All Indica | 2759 | 32.00% | 10.10% | 1.59% | 56.29% | NA |
| All Japonica | 1512 | 91.30% | 7.60% | 0.00% | 1.06% | NA |
| Aus | 269 | 83.60% | 2.60% | 0.00% | 13.75% | NA |
| Indica I | 595 | 25.90% | 0.50% | 1.68% | 71.93% | NA |
| Indica II | 465 | 6.00% | 9.70% | 3.01% | 81.29% | NA |
| Indica III | 913 | 41.60% | 15.30% | 0.77% | 42.28% | NA |
| Indica Intermediate | 786 | 40.80% | 11.60% | 1.65% | 45.93% | NA |
| Temperate Japonica | 767 | 85.10% | 13.70% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 99.20% | 0.40% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 94.60% | 3.30% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 87.50% | 8.30% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 64.40% | 6.70% | 3.33% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610442142 | G -> A | LOC_Os06g17970.1 | upstream_gene_variant ; 2910.0bp to feature; MODIFIER | silent_mutation | Average:16.17; most accessible tissue: Callus, score: 56.912 | N | N | N | N |
| vg0610442142 | G -> A | LOC_Os06g17950.1 | downstream_gene_variant ; 235.0bp to feature; MODIFIER | silent_mutation | Average:16.17; most accessible tissue: Callus, score: 56.912 | N | N | N | N |
| vg0610442142 | G -> A | LOC_Os06g17960.1 | downstream_gene_variant ; 495.0bp to feature; MODIFIER | silent_mutation | Average:16.17; most accessible tissue: Callus, score: 56.912 | N | N | N | N |
| vg0610442142 | G -> A | LOC_Os06g17950-LOC_Os06g17960 | intergenic_region ; MODIFIER | silent_mutation | Average:16.17; most accessible tissue: Callus, score: 56.912 | N | N | N | N |
| vg0610442142 | G -> DEL | N | N | silent_mutation | Average:16.17; most accessible tissue: Callus, score: 56.912 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610442142 | 1.11E-09 | 4.95E-13 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 3.97E-07 | NA | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 7.19E-11 | 2.07E-12 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 2.37E-12 | 1.70E-15 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 1.70E-08 | 2.77E-11 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 4.59E-09 | 2.08E-09 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 7.79E-08 | 7.05E-10 | mr1091 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 3.91E-07 | 4.24E-09 | mr1096 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 5.09E-06 | NA | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | NA | 2.17E-07 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 3.63E-07 | 2.29E-09 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 4.68E-08 | 1.20E-10 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 6.08E-08 | 2.59E-10 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | NA | 1.71E-07 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 1.45E-06 | 1.09E-08 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 3.05E-06 | NA | mr1695 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 2.63E-06 | 8.11E-09 | mr1695 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 1.19E-09 | NA | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 3.76E-15 | 4.59E-14 | mr1065_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 1.18E-08 | NA | mr1067_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 1.34E-10 | NA | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 4.60E-17 | 1.42E-16 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 2.06E-06 | NA | mr1078_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 1.69E-12 | 7.67E-15 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 1.54E-08 | NA | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 1.25E-14 | 3.35E-14 | mr1087_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 2.43E-09 | NA | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 8.12E-14 | 1.74E-11 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 1.25E-08 | NA | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 5.16E-13 | 1.33E-12 | mr1091_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 4.83E-07 | NA | mr1094_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 4.42E-09 | 1.08E-07 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 2.51E-08 | NA | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 4.10E-13 | 2.09E-12 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 6.48E-07 | NA | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 1.56E-11 | 7.96E-11 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 2.19E-06 | NA | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 4.80E-07 | 9.53E-09 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 1.26E-09 | NA | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 9.08E-18 | 2.63E-14 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 5.94E-09 | NA | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 2.06E-12 | 2.99E-12 | mr1112_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 4.29E-08 | NA | mr1121_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 1.44E-12 | 1.55E-12 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 1.48E-10 | NA | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 6.08E-15 | 4.36E-14 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 4.02E-09 | NA | mr1200_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 1.27E-10 | 2.16E-10 | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 2.57E-08 | NA | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 6.47E-12 | 4.63E-11 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 3.90E-08 | NA | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 3.19E-12 | 1.28E-10 | mr1234_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 4.98E-06 | NA | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 5.74E-06 | NA | mr1526_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 2.53E-11 | 1.87E-11 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442142 | 7.52E-08 | 7.13E-08 | mr1695_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |