Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0610429643:

Variant ID: vg0610429643 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10429643
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.55, A: 0.45, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTGAATATAAAAATATGACAACTTCAAAACAATATTTTCAAATACTAAATGATTTCAACTAAAAACGTTATCAACAACAAAGTTGTATAACTCATCAA[A/G]
ATCTATAACTTTTATTTTGATCATTTTTCTATATAACTTTTTTTTGAACAGTTTAAATTTAAATTTGAAAACATGACAACTTCAAACAACATTTTTAAAT

Reverse complement sequence

ATTTAAAAATGTTGTTTGAAGTTGTCATGTTTTCAAATTTAAATTTAAACTGTTCAAAAAAAAGTTATATAGAAAAATGATCAAAATAAAAGTTATAGAT[T/C]
TTGATGAGTTATACAACTTTGTTGTTGATAACGTTTTTAGTTGAAATCATTTAGTATTTGAAAATATTGTTTTGAAGTTGTCATATTTTTATATTCAAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 10.30% 0.17% 0.80% NA
All Indica  2759 89.30% 10.40% 0.22% 0.07% NA
All Japonica  1512 88.20% 11.80% 0.07% 0.00% NA
Aus  269 86.60% 0.70% 0.00% 12.64% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 91.20% 8.60% 0.22% 0.00% NA
Indica III  913 81.20% 18.30% 0.55% 0.00% NA
Indica Intermediate  786 89.80% 9.90% 0.00% 0.25% NA
Temperate Japonica  767 86.00% 13.80% 0.13% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 74.30% 25.70% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 16.70% 0.00% 2.08% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610429643 A -> G LOC_Os06g17930.1 downstream_gene_variant ; 2086.0bp to feature; MODIFIER silent_mutation Average:14.516; most accessible tissue: Minghui63 flag leaf, score: 20.769 N N N N
vg0610429643 A -> G LOC_Os06g17930-LOC_Os06g17950 intergenic_region ; MODIFIER silent_mutation Average:14.516; most accessible tissue: Minghui63 flag leaf, score: 20.769 N N N N
vg0610429643 A -> DEL N N silent_mutation Average:14.516; most accessible tissue: Minghui63 flag leaf, score: 20.769 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610429643 7.40E-08 4.33E-12 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 7.32E-08 1.15E-10 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 5.24E-09 5.13E-13 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 NA 7.37E-09 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 9.17E-07 4.18E-08 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 5.53E-07 3.71E-09 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 NA 7.51E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 5.05E-06 3.68E-08 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 5.82E-07 5.19E-10 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 8.37E-06 1.07E-08 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 NA 2.77E-06 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 NA 5.47E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 1.12E-07 1.98E-09 mr1695 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 4.23E-07 NA mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 1.12E-10 4.54E-13 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 5.19E-08 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 1.37E-12 7.40E-15 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 1.51E-06 NA mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 2.32E-09 1.32E-13 mr1078_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 3.91E-07 6.20E-11 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 4.79E-07 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 4.85E-09 5.72E-10 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 2.94E-09 1.44E-11 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 2.37E-07 1.44E-07 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 3.33E-06 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 3.60E-09 1.58E-11 mr1096_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 6.10E-07 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 5.08E-06 2.38E-08 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 2.83E-09 4.01E-11 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 5.65E-06 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 2.18E-07 2.80E-10 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 2.53E-07 NA mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 3.88E-09 5.04E-11 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 1.48E-06 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 3.17E-10 3.76E-12 mr1144_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 3.85E-07 NA mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 1.72E-07 5.59E-09 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 8.35E-07 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 1.72E-09 6.19E-10 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 7.25E-07 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 1.14E-06 NA mr1244_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 1.48E-07 1.78E-09 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610429643 4.80E-10 5.74E-09 mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251