Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610428814:

Variant ID: vg0610428814 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10428814
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCAAAATGAGGTGAGCTATTACACTAGTACAGAACCTTTCATCTGTGAACATGCTTGGAATTAGCGGCCGTCACAAGAAATTCATCTCAATCGGGTCGA[C/A]
AAAGCGCCGGATTGAGATAACTCAGGCCCGTCACGGATCACACATATCAGTGACGGGCCGTAGTTTAGACCCGATTGAGATAACATTCCATATCTCGATC

Reverse complement sequence

GATCGAGATATGGAATGTTATCTCAATCGGGTCTAAACTACGGCCCGTCACTGATATGTGTGATCCGTGACGGGCCTGAGTTATCTCAATCCGGCGCTTT[G/T]
TCGACCCGATTGAGATGAATTTCTTGTGACGGCCGCTAATTCCAAGCATGTTCACAGATGAAAGGTTCTGTACTAGTGTAATAGCTCACCTCATTTTGCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.80%	10.30%	0.06%	0.83%	NA
All Indica	2759	89.50%	10.40%	0.04%	0.07%	NA
All Japonica	1512	88.20%	11.80%	0.07%	0.00%	NA
Aus	269	86.60%	0.70%	0.00%	12.64%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	91.20%	8.60%	0.22%	0.00%	NA
Indica III	913	81.40%	18.60%	0.00%	0.00%	NA
Indica Intermediate	786	90.20%	9.50%	0.00%	0.25%	NA
Temperate Japonica	767	86.00%	13.80%	0.13%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	74.30%	25.70%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	16.70%	0.00%	2.08%	NA
Intermediate	90	91.10%	6.70%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610428814	C -> A	LOC_Os06g17930.1	downstream_gene_variant ; 1257.0bp to feature; MODIFIER	silent_mutation	Average:71.199; most accessible tissue: Zhenshan97 root, score: 85.912	N	N	N	N
vg0610428814	C -> A	LOC_Os06g17930-LOC_Os06g17950	intergenic_region ; MODIFIER	silent_mutation	Average:71.199; most accessible tissue: Zhenshan97 root, score: 85.912	N	N	N	N
vg0610428814	C -> DEL	N	N	silent_mutation	Average:71.199; most accessible tissue: Zhenshan97 root, score: 85.912	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610428814	7.17E-08	1.69E-11	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	1.71E-08	2.17E-10	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	2.24E-10	1.59E-13	mr1078	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	NA	8.45E-09	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	8.39E-07	7.41E-08	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	9.27E-06	NA	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	1.54E-06	3.43E-08	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	NA	1.35E-06	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	1.19E-06	2.83E-08	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	4.65E-07	1.52E-09	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	2.20E-06	9.63E-09	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	NA	2.91E-06	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	NA	8.37E-06	mr1233	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	NA	1.85E-07	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	1.23E-08	5.75E-10	mr1695	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	1.81E-06	NA	mr1065_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	5.63E-11	2.67E-12	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	2.73E-08	NA	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	2.28E-13	3.47E-14	mr1068_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	9.22E-06	NA	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	2.95E-09	1.43E-12	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	1.88E-07	8.75E-11	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	8.40E-07	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	3.19E-09	1.36E-09	mr1090_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	3.06E-09	8.00E-11	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	6.02E-07	8.59E-07	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	5.75E-06	NA	mr1096_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	3.21E-09	8.56E-11	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	2.61E-07	NA	mr1108_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	7.10E-06	1.39E-07	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	1.69E-09	1.62E-10	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	5.93E-06	NA	mr1112_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	1.10E-07	9.30E-10	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	6.02E-07	NA	mr1121_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	4.22E-09	2.44E-10	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	8.29E-07	NA	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	1.85E-10	1.15E-11	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	2.48E-07	NA	mr1200_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	5.03E-08	2.10E-08	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	2.66E-07	NA	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	6.32E-10	9.44E-10	mr1211_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	2.79E-07	NA	mr1234_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	3.05E-06	NA	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	1.40E-07	3.68E-09	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	4.94E-06	NA	mr1695_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610428814	4.90E-11	1.98E-09	mr1695_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251