Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610418246:

Variant ID: vg0610418246 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10418246
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, G: 0.04, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

CGAATCTGAATGGAAGGTTACTAGAGTTTATTCAGATTGATTGTACTAGGTTGTATCTATTCTATTACTAGGTTGCTATATTTTAGGATAGAGAGAGTAT[G/C]
AAATGACTTGTTGAACTAATAGTGGTGTTAAGAGCCTCTTTGGGGAGCTTCTAGCAGTTATAATTTCTCCCATAATATATAGATTTCCATACAGTGTAGA

Reverse complement sequence

TCTACACTGTATGGAAATCTATATATTATGGGAGAAATTATAACTGCTAGAAGCTCCCCAAAGAGGCTCTTAACACCACTATTAGTTCAACAAGTCATTT[C/G]
ATACTCTCTCTATCCTAAAATATAGCAACCTAGTAATAGAATAGATACAACCTAGTACAATCAATCTGAATAAACTCTAGTAACCTTCCATTCAGATTCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.80%	28.40%	1.99%	33.86%	NA
All Indica	2759	36.00%	9.70%	2.32%	51.98%	NA
All Japonica	1512	42.20%	49.50%	1.59%	6.75%	NA
Aus	269	3.70%	82.90%	0.37%	13.01%	NA
Indica I	595	10.90%	9.40%	3.53%	76.13%	NA
Indica II	465	26.00%	1.90%	1.72%	70.32%	NA
Indica III	913	59.50%	10.20%	0.77%	29.57%	NA
Indica Intermediate	786	33.70%	13.90%	3.56%	48.85%	NA
Temperate Japonica	767	44.70%	42.90%	0.65%	11.73%	NA
Tropical Japonica	504	32.30%	62.10%	3.37%	2.18%	NA
Japonica Intermediate	241	54.80%	44.00%	0.83%	0.41%	NA
VI/Aromatic	96	17.70%	79.20%	0.00%	3.12%	NA
Intermediate	90	34.40%	31.10%	5.56%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610418246	G -> C	LOC_Os06g17930.1	upstream_gene_variant ; 2457.0bp to feature; MODIFIER	silent_mutation	Average:53.846; most accessible tissue: Callus, score: 78.287	N	N	N	N
vg0610418246	G -> C	LOC_Os06g17920.1	downstream_gene_variant ; 2951.0bp to feature; MODIFIER	silent_mutation	Average:53.846; most accessible tissue: Callus, score: 78.287	N	N	N	N
vg0610418246	G -> C	LOC_Os06g17920-LOC_Os06g17930	intergenic_region ; MODIFIER	silent_mutation	Average:53.846; most accessible tissue: Callus, score: 78.287	N	N	N	N
vg0610418246	G -> DEL	N	N	silent_mutation	Average:53.846; most accessible tissue: Callus, score: 78.287	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610418246	NA	7.30E-10	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	3.21E-06	NA	mr1087	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	1.09E-06	3.13E-11	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	NA	1.47E-09	mr1108	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	NA	5.29E-08	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	NA	6.37E-08	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	3.88E-06	8.24E-09	mr1218	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	4.29E-06	9.28E-12	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	NA	3.69E-09	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	NA	3.73E-06	mr1242	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	2.18E-06	1.64E-10	mr1422	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	7.91E-07	NA	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	3.77E-08	1.01E-13	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	3.21E-06	1.03E-10	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	9.20E-07	NA	mr1067_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	3.62E-06	4.02E-12	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	2.67E-06	NA	mr1091_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	4.72E-07	4.76E-12	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	NA	5.37E-10	mr1108_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	NA	2.38E-07	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	9.02E-07	1.38E-10	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	NA	1.52E-08	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	NA	2.71E-08	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	1.68E-08	9.37E-15	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	NA	3.31E-11	mr1234_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	NA	1.93E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	3.19E-07	2.70E-12	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246	1.14E-06	1.94E-12	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251