\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610418246:

Variant ID: vg0610418246 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10418246
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, G: 0.04, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


CGAATCTGAATGGAAGGTTACTAGAGTTTATTCAGATTGATTGTACTAGGTTGTATCTATTCTATTACTAGGTTGCTATATTTTAGGATAGAGAGAGTAT[G/C]
AAATGACTTGTTGAACTAATAGTGGTGTTAAGAGCCTCTTTGGGGAGCTTCTAGCAGTTATAATTTCTCCCATAATATATAGATTTCCATACAGTGTAGA

Reverse complement sequence

TCTACACTGTATGGAAATCTATATATTATGGGAGAAATTATAACTGCTAGAAGCTCCCCAAAGAGGCTCTTAACACCACTATTAGTTCAACAAGTCATTT[C/G]
ATACTCTCTCTATCCTAAAATATAGCAACCTAGTAATAGAATAGATACAACCTAGTACAATCAATCTGAATAAACTCTAGTAACCTTCCATTCAGATTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.80% 28.40% 1.99% 33.86% NA
All Indica  2759 36.00% 9.70% 2.32% 51.98% NA
All Japonica  1512 42.20% 49.50% 1.59% 6.75% NA
Aus  269 3.70% 82.90% 0.37% 13.01% NA
Indica I  595 10.90% 9.40% 3.53% 76.13% NA
Indica II  465 26.00% 1.90% 1.72% 70.32% NA
Indica III  913 59.50% 10.20% 0.77% 29.57% NA
Indica Intermediate  786 33.70% 13.90% 3.56% 48.85% NA
Temperate Japonica  767 44.70% 42.90% 0.65% 11.73% NA
Tropical Japonica  504 32.30% 62.10% 3.37% 2.18% NA
Japonica Intermediate  241 54.80% 44.00% 0.83% 0.41% NA
VI/Aromatic  96 17.70% 79.20% 0.00% 3.12% NA
Intermediate  90 34.40% 31.10% 5.56% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610418246 G -> C LOC_Os06g17930.1 upstream_gene_variant ; 2457.0bp to feature; MODIFIER silent_mutation Average:53.846; most accessible tissue: Callus, score: 78.287 N N N N
vg0610418246 G -> C LOC_Os06g17920.1 downstream_gene_variant ; 2951.0bp to feature; MODIFIER silent_mutation Average:53.846; most accessible tissue: Callus, score: 78.287 N N N N
vg0610418246 G -> C LOC_Os06g17920-LOC_Os06g17930 intergenic_region ; MODIFIER silent_mutation Average:53.846; most accessible tissue: Callus, score: 78.287 N N N N
vg0610418246 G -> DEL N N silent_mutation Average:53.846; most accessible tissue: Callus, score: 78.287 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610418246 NA 7.30E-10 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 3.21E-06 NA mr1087 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 1.09E-06 3.13E-11 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 NA 1.47E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 NA 5.29E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 NA 6.37E-08 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 3.88E-06 8.24E-09 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 4.29E-06 9.28E-12 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 NA 3.69E-09 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 NA 3.73E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 2.18E-06 1.64E-10 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 7.91E-07 NA mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 3.77E-08 1.01E-13 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 3.21E-06 1.03E-10 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 9.20E-07 NA mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 3.62E-06 4.02E-12 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 2.67E-06 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 4.72E-07 4.76E-12 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 NA 5.37E-10 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 NA 2.38E-07 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 9.02E-07 1.38E-10 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 NA 1.52E-08 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 NA 2.71E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 1.68E-08 9.37E-15 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 NA 3.31E-11 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 NA 1.93E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 3.19E-07 2.70E-12 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610418246 1.14E-06 1.94E-12 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251