\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610417183:

Variant ID: vg0610417183 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10417183
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, T: 0.23, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


CATTCTGAGTAATTAAGATTTTCTTAATGAGAATTACTTCTTGGTTAGTTCCTAATTAGCATACATGATCATTGTTCACTGTAGTCTATTAAATTATAGT[T/G]
ATTGATTTAGTGTTTGATCGGCACTAGAGTAGTTATTAATTGCGTAGACGCGGTGTCTGTGTAATTAATTTCCTGTTGTTGTTGTGTATCCCATAGTACG

Reverse complement sequence

CGTACTATGGGATACACAACAACAACAGGAAATTAATTACACAGACACCGCGTCTACGCAATTAATAACTACTCTAGTGCCGATCAAACACTAAATCAAT[A/C]
ACTATAATTTAATAGACTACAGTGAACAATGATCATGTATGCTAATTAGGAACTAACCAAGAAGTAATTCTCATTAAGAAAATCTTAATTACTCAGAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.10% 29.50% 3.03% 36.42% NA
All Indica  2759 33.50% 10.50% 2.03% 54.01% NA
All Japonica  1512 32.90% 50.90% 5.36% 10.85% NA
Aus  269 3.70% 82.90% 0.37% 13.01% NA
Indica I  595 5.40% 10.60% 4.37% 79.66% NA
Indica II  465 25.20% 2.40% 2.37% 70.11% NA
Indica III  913 58.50% 10.80% 0.55% 30.12% NA
Indica Intermediate  786 30.70% 14.80% 1.78% 52.80% NA
Temperate Japonica  767 43.30% 44.70% 9.26% 2.74% NA
Tropical Japonica  504 11.30% 63.30% 1.79% 23.61% NA
Japonica Intermediate  241 45.20% 44.40% 0.41% 9.96% NA
VI/Aromatic  96 11.50% 85.40% 0.00% 3.12% NA
Intermediate  90 27.80% 34.40% 5.56% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610417183 T -> G LOC_Os06g17930.1 upstream_gene_variant ; 3520.0bp to feature; MODIFIER silent_mutation Average:9.932; most accessible tissue: Callus, score: 45.343 N N N N
vg0610417183 T -> G LOC_Os06g17920.1 downstream_gene_variant ; 1888.0bp to feature; MODIFIER silent_mutation Average:9.932; most accessible tissue: Callus, score: 45.343 N N N N
vg0610417183 T -> G LOC_Os06g17920-LOC_Os06g17930 intergenic_region ; MODIFIER silent_mutation Average:9.932; most accessible tissue: Callus, score: 45.343 N N N N
vg0610417183 T -> DEL N N silent_mutation Average:9.932; most accessible tissue: Callus, score: 45.343 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610417183 4.33E-08 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610417183 2.72E-07 6.11E-09 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610417183 NA 4.92E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610417183 1.58E-06 3.71E-08 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610417183 NA 1.80E-07 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610417183 NA 6.33E-07 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610417183 9.41E-06 9.91E-08 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610417183 NA 2.33E-09 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610417183 7.19E-07 NA mr1067_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610417183 3.07E-09 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610417183 4.65E-06 9.36E-11 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610417183 1.97E-07 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610417183 3.85E-06 NA mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610417183 NA 2.05E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610417183 1.14E-07 NA mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251