Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610412517:

Variant ID: vg0610412517 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10412517
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

AATTTCTTGGCTCCGCCGCTGCTTGAATCGATATGTCATATGCTGCAAATTAAGTGAATTGGAGATGTACATGCGCTCGCTATATTGTAATTGTGGGGTA[G/A]
CAACTTTATCTCGGGTACAACCATGGAACAAGGGTGATGAATCAAACTATTTGCTGTCATTTGAAGAGCTCCAGCAGACATATTTCATGAAATTGTACTA

Reverse complement sequence

TAGTACAATTTCATGAAATATGTCTGCTGGAGCTCTTCAAATGACAGCAAATAGTTTGATTCATCACCCTTGTTCCATGGTTGTACCCGAGATAAAGTTG[C/T]
TACCCCACAATTACAATATAGCGAGCGCATGTACATCTCCAATTCACTTAATTTGCAGCATATGACATATCGATTCAAGCAGCGGCGGAGCCAAGAAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.70%	12.10%	10.50%	6.67%	NA
All Indica	2759	57.60%	14.10%	16.96%	11.31%	NA
All Japonica	1512	88.40%	11.20%	0.33%	0.13%	NA
Aus	269	95.50%	0.00%	4.46%	0.00%	NA
Indica I	595	21.50%	24.00%	33.45%	21.01%	NA
Indica II	465	31.60%	20.20%	27.96%	20.22%	NA
Indica III	913	90.10%	3.80%	3.29%	2.74%	NA
Indica Intermediate	786	62.60%	14.90%	13.87%	8.65%	NA
Temperate Japonica	767	97.70%	1.80%	0.26%	0.26%	NA
Tropical Japonica	504	73.60%	26.00%	0.40%	0.00%	NA
Japonica Intermediate	241	89.60%	10.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	71.10%	15.60%	12.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610412517	G -> A	LOC_Os06g17920.1	intron_variant ; MODIFIER	silent_mutation	Average:61.825; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0610412517	G -> DEL	N	N	silent_mutation	Average:61.825; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610412517	7.47E-11	NA	mr1068	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	2.60E-09	2.60E-09	mr1068	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	9.32E-06	7.35E-07	mr1078	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	NA	6.22E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	3.92E-11	NA	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	2.35E-06	1.78E-07	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	2.10E-08	1.91E-10	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	1.85E-06	1.35E-07	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	NA	4.17E-06	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	2.11E-06	2.11E-06	mr1110	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	8.02E-06	NA	mr1121	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	6.53E-06	9.31E-09	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	4.61E-07	NA	mr1144	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	1.65E-12	NA	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	4.81E-08	2.42E-10	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	8.41E-07	7.27E-08	mr1211	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	2.05E-06	NA	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	6.25E-08	1.23E-09	mr1068_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	4.45E-06	2.12E-07	mr1078_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	2.97E-07	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	NA	2.62E-06	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	6.02E-09	4.65E-11	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	3.15E-06	3.37E-07	mr1094_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	4.34E-06	6.86E-08	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	3.18E-06	3.28E-08	mr1110_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	NA	7.65E-07	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	NA	1.86E-07	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	NA	2.43E-06	mr1200_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	9.49E-11	NA	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	NA	2.33E-08	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610412517	1.03E-08	1.15E-10	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251