\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610397337:

Variant ID: vg0610397337 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10397337
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGAGCTAAGGGTGGAGTGAGAATTGTTGATGTGACAGAGAAATATTTTAATGAGTTGATTGACTGAAGTATGATTCAAGCATCTAGAGTGAACATAGAC[A/G]
AAGGTACTATTAAGAGCTGCCGAGTCCATGATATCATGCATGATGTAATGATATCAATATTGGAAGAAAATTTTGTATATTTGATGAGGGATGATGGAAC

Reverse complement sequence

GTTCCATCATCCCTCATCAAATATACAAAATTTTCTTCCAATATTGATATCATTACATCATGCATGATATCATGGACTCGGCAGCTCTTAATAGTACCTT[T/C]
GTCTATGTTCACTCTAGATGCTTGAATCATACTTCAGTCAATCAACTCATTAAAATATTTCTCTGTCACATCAACAATTCTCACTCCACCCTTAGCTCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 2.60% 2.58% 39.91% NA
All Indica  2759 37.80% 4.10% 3.52% 54.55% NA
All Japonica  1512 78.60% 0.10% 1.46% 19.84% NA
Aus  269 86.60% 0.00% 0.00% 13.38% NA
Indica I  595 15.10% 0.20% 3.53% 81.18% NA
Indica II  465 23.70% 0.20% 6.02% 70.11% NA
Indica III  913 53.20% 9.00% 2.52% 35.27% NA
Indica Intermediate  786 45.40% 3.80% 3.18% 47.58% NA
Temperate Japonica  767 91.90% 0.00% 0.52% 7.56% NA
Tropical Japonica  504 66.30% 0.00% 0.40% 33.33% NA
Japonica Intermediate  241 62.20% 0.40% 6.64% 30.71% NA
VI/Aromatic  96 82.30% 6.20% 1.04% 10.42% NA
Intermediate  90 57.80% 1.10% 2.22% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610397337 A -> G LOC_Os06g17910.1 intron_variant ; MODIFIER silent_mutation Average:12.201; most accessible tissue: Callus, score: 54.651 N N N N
vg0610397337 A -> DEL N N silent_mutation Average:12.201; most accessible tissue: Callus, score: 54.651 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610397337 1.94E-06 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610397337 4.57E-07 5.40E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610397337 8.34E-06 3.76E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610397337 NA 2.63E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610397337 3.87E-07 NA mr1695 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610397337 5.46E-08 6.73E-11 mr1695 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610397337 NA 5.79E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610397337 1.55E-07 5.05E-08 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610397337 3.94E-07 NA mr1695_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610397337 NA 1.63E-09 mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251