\
| Variant ID: vg0610397337 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10397337 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAGAGCTAAGGGTGGAGTGAGAATTGTTGATGTGACAGAGAAATATTTTAATGAGTTGATTGACTGAAGTATGATTCAAGCATCTAGAGTGAACATAGAC[A/G]
AAGGTACTATTAAGAGCTGCCGAGTCCATGATATCATGCATGATGTAATGATATCAATATTGGAAGAAAATTTTGTATATTTGATGAGGGATGATGGAAC
GTTCCATCATCCCTCATCAAATATACAAAATTTTCTTCCAATATTGATATCATTACATCATGCATGATATCATGGACTCGGCAGCTCTTAATAGTACCTT[T/C]
GTCTATGTTCACTCTAGATGCTTGAATCATACTTCAGTCAATCAACTCATTAAAATATTTCTCTGTCACATCAACAATTCTCACTCCACCCTTAGCTCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.90% | 2.60% | 2.58% | 39.91% | NA |
| All Indica | 2759 | 37.80% | 4.10% | 3.52% | 54.55% | NA |
| All Japonica | 1512 | 78.60% | 0.10% | 1.46% | 19.84% | NA |
| Aus | 269 | 86.60% | 0.00% | 0.00% | 13.38% | NA |
| Indica I | 595 | 15.10% | 0.20% | 3.53% | 81.18% | NA |
| Indica II | 465 | 23.70% | 0.20% | 6.02% | 70.11% | NA |
| Indica III | 913 | 53.20% | 9.00% | 2.52% | 35.27% | NA |
| Indica Intermediate | 786 | 45.40% | 3.80% | 3.18% | 47.58% | NA |
| Temperate Japonica | 767 | 91.90% | 0.00% | 0.52% | 7.56% | NA |
| Tropical Japonica | 504 | 66.30% | 0.00% | 0.40% | 33.33% | NA |
| Japonica Intermediate | 241 | 62.20% | 0.40% | 6.64% | 30.71% | NA |
| VI/Aromatic | 96 | 82.30% | 6.20% | 1.04% | 10.42% | NA |
| Intermediate | 90 | 57.80% | 1.10% | 2.22% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610397337 | A -> G | LOC_Os06g17910.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.201; most accessible tissue: Callus, score: 54.651 | N | N | N | N |
| vg0610397337 | A -> DEL | N | N | silent_mutation | Average:12.201; most accessible tissue: Callus, score: 54.651 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610397337 | 1.94E-06 | NA | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610397337 | 4.57E-07 | 5.40E-08 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610397337 | 8.34E-06 | 3.76E-07 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610397337 | NA | 2.63E-07 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610397337 | 3.87E-07 | NA | mr1695 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610397337 | 5.46E-08 | 6.73E-11 | mr1695 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610397337 | NA | 5.79E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610397337 | 1.55E-07 | 5.05E-08 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610397337 | 3.94E-07 | NA | mr1695_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610397337 | NA | 1.63E-09 | mr1695_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |