Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610394969:

Variant ID: vg0610394969 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10394969
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

CAACTCACCTGAAACGGATAAAGATGGCACCAACGGAGGTTTGCATCGACGGCGCACTAGGGGCAATGACGAATAGACAACTTCCACTCGTCAAACCTGG[T/C]
TGTTTCATAAGAATATGGTGGGAAGCAGAGAAGCTGGGATGTGTCGAGGTCGTTTGGTTTTCTTTTCTTTTTTGATTGTGTGTTCTCCTCGTTGTTGAGG

Reverse complement sequence

CCTCAACAACGAGGAGAACACACAATCAAAAAAGAAAAGAAAACCAAACGACCTCGACACATCCCAGCTTCTCTGCTTCCCACCATATTCTTATGAAACA[A/G]
CCAGGTTTGACGAGTGGAAGTTGTCTATTCGTCATTGCCCCTAGTGCGCCGTCGATGCAAACCTCCGTTGGTGCCATCTTTATCCGTTTCAGGTGAGTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.70%	25.60%	1.02%	38.72%	NA
All Indica	2759	41.60%	4.70%	1.41%	52.23%	NA
All Japonica	1512	29.60%	49.70%	0.26%	20.50%	NA
Aus	269	3.30%	82.50%	0.37%	13.75%	NA
Indica I	595	4.70%	9.60%	1.34%	84.37%	NA
Indica II	465	25.40%	1.90%	1.51%	71.18%	NA
Indica III	913	70.60%	1.60%	0.55%	27.16%	NA
Indica Intermediate	786	45.40%	6.40%	2.42%	45.80%	NA
Temperate Japonica	767	51.00%	42.80%	0.00%	6.26%	NA
Tropical Japonica	504	1.00%	63.10%	0.40%	35.52%	NA
Japonica Intermediate	241	21.20%	43.60%	0.83%	34.44%	NA
VI/Aromatic	96	15.60%	78.10%	0.00%	6.25%	NA
Intermediate	90	22.20%	33.30%	4.44%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610394969	T -> C	LOC_Os06g17910.1	upstream_gene_variant ; 2128.0bp to feature; MODIFIER	silent_mutation	Average:12.652; most accessible tissue: Callus, score: 60.359	N	N	N	N
vg0610394969	T -> C	LOC_Os06g17900.1	downstream_gene_variant ; 4504.0bp to feature; MODIFIER	silent_mutation	Average:12.652; most accessible tissue: Callus, score: 60.359	N	N	N	N
vg0610394969	T -> C	LOC_Os06g17900-LOC_Os06g17910	intergenic_region ; MODIFIER	silent_mutation	Average:12.652; most accessible tissue: Callus, score: 60.359	N	N	N	N
vg0610394969	T -> DEL	N	N	silent_mutation	Average:12.652; most accessible tissue: Callus, score: 60.359	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610394969	NA	3.05E-11	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	1.25E-11	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	8.00E-08	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	3.26E-07	NA	mr1087	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	2.27E-10	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	5.88E-06	NA	mr1091	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	6.56E-14	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	5.31E-08	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	1.98E-11	mr1108	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	4.04E-09	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	9.77E-11	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	4.13E-08	mr1218	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	1.09E-06	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	2.99E-10	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	3.26E-06	mr1422	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	8.43E-07	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	4.50E-07	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	1.14E-15	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	8.84E-13	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	9.34E-08	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	4.52E-11	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	5.28E-09	NA	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	2.58E-12	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	1.82E-07	NA	mr1091_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	1.92E-14	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	5.69E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	8.33E-14	mr1108_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	1.16E-09	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	7.85E-13	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	5.22E-11	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	1.09E-13	mr1234_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	6.41E-07	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	6.92E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	1.88E-10	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	6.00E-08	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	3.16E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	6.83E-08	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610394969	NA	7.74E-08	mr1877_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251