\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610273485:

Variant ID: vg0610273485 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10273485
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAGCATGGGGGCTCGGGCCCTTTTATAGGCGGCGTGGCATGGCGGGACGTGGCGGTGAGCTGGCGTCTAGGCGCGGGAGAACTGTGGGTAGCTGGCTAG[C/T]
CACTACAGCGGGAATCCGGGAGGGGATGGCGACGCGACAGCGTGGCGTCACGCACCGGTGGCGATGCGACGGCGAAAACGACGGTGACATGACACGAGGT

Reverse complement sequence

ACCTCGTGTCATGTCACCGTCGTTTTCGCCGTCGCATCGCCACCGGTGCGTGACGCCACGCTGTCGCGTCGCCATCCCCTCCCGGATTCCCGCTGTAGTG[G/A]
CTAGCCAGCTACCCACAGTTCTCCCGCGCCTAGACGCCAGCTCACCGCCACGTCCCGCCATGCCACGCCGCCTATAAAAGGGCCCGAGCCCCCATGCTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 4.60% 6.31% 0.00% NA
All Indica  2759 81.50% 7.90% 10.62% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 39.70% 26.90% 33.45% 0.00% NA
Indica II  465 89.20% 3.20% 7.53% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 87.20% 5.30% 7.51% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 1.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610273485 C -> T LOC_Os06g17690.1 downstream_gene_variant ; 2447.0bp to feature; MODIFIER silent_mutation Average:69.812; most accessible tissue: Zhenshan97 young leaf, score: 81.353 N N N N
vg0610273485 C -> T LOC_Os06g17690-LOC_Os06g17700 intergenic_region ; MODIFIER silent_mutation Average:69.812; most accessible tissue: Zhenshan97 young leaf, score: 81.353 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610273485 5.04E-06 NA mr1065 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610273485 NA 2.74E-10 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610273485 NA 1.95E-12 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610273485 1.76E-06 NA mr1108 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610273485 7.85E-06 7.85E-12 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610273485 NA 2.40E-09 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610273485 5.60E-07 NA mr1234 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610273485 7.43E-06 6.33E-12 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610273485 5.62E-07 NA mr1237 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610273485 NA 1.43E-08 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610273485 NA 6.06E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610273485 NA 6.63E-11 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610273485 NA 1.60E-09 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610273485 NA 2.14E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610273485 NA 7.01E-11 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610273485 NA 1.56E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251