\
| Variant ID: vg0610273485 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10273485 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGAGCATGGGGGCTCGGGCCCTTTTATAGGCGGCGTGGCATGGCGGGACGTGGCGGTGAGCTGGCGTCTAGGCGCGGGAGAACTGTGGGTAGCTGGCTAG[C/T]
CACTACAGCGGGAATCCGGGAGGGGATGGCGACGCGACAGCGTGGCGTCACGCACCGGTGGCGATGCGACGGCGAAAACGACGGTGACATGACACGAGGT
ACCTCGTGTCATGTCACCGTCGTTTTCGCCGTCGCATCGCCACCGGTGCGTGACGCCACGCTGTCGCGTCGCCATCCCCTCCCGGATTCCCGCTGTAGTG[G/A]
CTAGCCAGCTACCCACAGTTCTCCCGCGCCTAGACGCCAGCTCACCGCCACGTCCCGCCATGCCACGCCGCCTATAAAAGGGCCCGAGCCCCCATGCTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 4.60% | 6.31% | 0.00% | NA |
| All Indica | 2759 | 81.50% | 7.90% | 10.62% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 39.70% | 26.90% | 33.45% | 0.00% | NA |
| Indica II | 465 | 89.20% | 3.20% | 7.53% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.20% | 5.30% | 7.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610273485 | C -> T | LOC_Os06g17690.1 | downstream_gene_variant ; 2447.0bp to feature; MODIFIER | silent_mutation | Average:69.812; most accessible tissue: Zhenshan97 young leaf, score: 81.353 | N | N | N | N |
| vg0610273485 | C -> T | LOC_Os06g17690-LOC_Os06g17700 | intergenic_region ; MODIFIER | silent_mutation | Average:69.812; most accessible tissue: Zhenshan97 young leaf, score: 81.353 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610273485 | 5.04E-06 | NA | mr1065 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610273485 | NA | 2.74E-10 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610273485 | NA | 1.95E-12 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610273485 | 1.76E-06 | NA | mr1108 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610273485 | 7.85E-06 | 7.85E-12 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610273485 | NA | 2.40E-09 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610273485 | 5.60E-07 | NA | mr1234 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610273485 | 7.43E-06 | 6.33E-12 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610273485 | 5.62E-07 | NA | mr1237 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610273485 | NA | 1.43E-08 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610273485 | NA | 6.06E-07 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610273485 | NA | 6.63E-11 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610273485 | NA | 1.60E-09 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610273485 | NA | 2.14E-10 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610273485 | NA | 7.01E-11 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610273485 | NA | 1.56E-07 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |