\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610205289:

Variant ID: vg0610205289 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10205289
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, C: 0.43, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAGCCAAACGTCTTCTGCTTCGAATCTTTTCTTCAACTGGGGTTTAATTGATTATTGCAAAGTGAGTACATGGAATACTCCGCAAGCCACACAACAAA[T/C]
ATGCAAGTGCACAAAATACACAAAGGATGGCATAATATATAGCTCAATACTTACTTTGAGATGCATTATCCCTAGTCTTGTTTAGAACCCTAAAATAGTT

Reverse complement sequence

AACTATTTTAGGGTTCTAAACAAGACTAGGGATAATGCATCTCAAAGTAAGTATTGAGCTATATATTATGCCATCCTTTGTGTATTTTGTGCACTTGCAT[A/G]
TTTGTTGTGTGGCTTGCGGAGTATTCCATGTACTCACTTTGCAATAATCAATTAAACCCCAGTTGAAGAAAAGATTCGAAGCAGAAGACGTTTGGCTTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.20% 11.70% 0.40% 3.75% NA
All Indica  2759 85.60% 8.70% 0.47% 5.22% NA
All Japonica  1512 81.50% 16.80% 0.26% 1.46% NA
Aus  269 82.50% 17.10% 0.00% 0.37% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 91.00% 2.20% 1.72% 5.16% NA
Indica III  913 72.50% 16.50% 0.55% 10.41% NA
Indica Intermediate  786 87.30% 9.50% 0.00% 3.18% NA
Temperate Japonica  767 66.50% 31.70% 0.39% 1.43% NA
Tropical Japonica  504 99.20% 0.20% 0.00% 0.60% NA
Japonica Intermediate  241 92.10% 4.10% 0.41% 3.32% NA
VI/Aromatic  96 87.50% 4.20% 1.04% 7.29% NA
Intermediate  90 88.90% 6.70% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610205289 T -> C LOC_Os06g17580.1 upstream_gene_variant ; 2354.0bp to feature; MODIFIER silent_mutation Average:27.41; most accessible tissue: Zhenshan97 young leaf, score: 41.875 N N N N
vg0610205289 T -> C LOC_Os06g17590.1 upstream_gene_variant ; 3866.0bp to feature; MODIFIER silent_mutation Average:27.41; most accessible tissue: Zhenshan97 young leaf, score: 41.875 N N N N
vg0610205289 T -> C LOC_Os06g17580-LOC_Os06g17590 intergenic_region ; MODIFIER silent_mutation Average:27.41; most accessible tissue: Zhenshan97 young leaf, score: 41.875 N N N N
vg0610205289 T -> DEL N N silent_mutation Average:27.41; most accessible tissue: Zhenshan97 young leaf, score: 41.875 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610205289 2.46E-06 6.53E-09 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0610205289 4.85E-07 1.88E-11 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 4.02E-09 2.27E-13 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 5.61E-09 8.60E-12 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 2.53E-10 1.20E-14 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 6.76E-11 7.41E-13 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 1.80E-06 NA mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 8.28E-07 9.14E-10 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 NA 6.59E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 5.74E-06 9.80E-10 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 NA 4.98E-09 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 1.45E-07 1.07E-10 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 1.39E-06 8.08E-11 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 NA 1.05E-08 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 NA 2.76E-08 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 1.45E-06 4.51E-09 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 2.35E-08 2.90E-13 mr1695 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 7.46E-09 NA mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 2.65E-13 6.23E-16 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 4.06E-08 1.33E-08 mr1078_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 8.55E-07 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 8.26E-13 2.16E-14 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 1.47E-13 1.45E-12 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 1.55E-07 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 1.98E-09 NA mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 NA 1.64E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 4.76E-07 1.18E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 6.26E-11 4.79E-11 mr1096_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 1.55E-07 NA mr1108_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 7.56E-12 3.01E-12 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 1.33E-08 2.46E-10 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 1.25E-08 5.49E-10 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 1.50E-11 1.36E-12 mr1144_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 9.43E-09 1.24E-10 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 1.65E-09 1.00E-09 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 5.57E-07 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 2.12E-09 1.34E-11 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205289 2.28E-11 3.50E-13 mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251