\
| Variant ID: vg0610191856 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10191856 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 259. )
ATTATTTCCACTTCCCATTTGTCTTTTTGATTAAGCAAATGTATTTTGAGACAGTAATCCCCGATTTCCACTTTTTGGACCAAGCACTAGTTCTTATCAA[C/T]
AGAGAATTCCCCTAGATCTCCCTCTAGCAGGTAACAAGGTCCAATCAAACAATTTCTTTCCACTTATATAATTCAGGAGATTATTGTTGAAATCCTATTT
AAATAGGATTTCAACAATAATCTCCTGAATTATATAAGTGGAAAGAAATTGTTTGATTGGACCTTGTTACCTGCTAGAGGGAGATCTAGGGGAATTCTCT[G/A]
TTGATAAGAACTAGTGCTTGGTCCAAAAAGTGGAAATCGGGGATTACTGTCTCAAAATACATTTGCTTAATCAAAAAGACAAATGGGAAGTGGAAATAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.40% | 11.60% | 2.03% | 0.00% | NA |
| All Indica | 2759 | 78.30% | 18.30% | 3.44% | 0.00% | NA |
| All Japonica | 1512 | 98.10% | 1.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 48.60% | 40.50% | 10.92% | 0.00% | NA |
| Indica II | 465 | 85.40% | 11.80% | 2.80% | 0.00% | NA |
| Indica III | 913 | 86.60% | 13.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.90% | 11.10% | 2.04% | 0.00% | NA |
| Temperate Japonica | 767 | 97.80% | 2.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610191856 | C -> T | LOC_Os06g17560-LOC_Os06g17570 | intergenic_region ; MODIFIER | silent_mutation | Average:29.152; most accessible tissue: Callus, score: 43.584 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610191856 | NA | 3.74E-10 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0610191856 | 1.99E-06 | NA | mr1695 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610191856 | 3.04E-06 | NA | mr1695 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610191856 | NA | 2.33E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610191856 | NA | 6.11E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610191856 | NA | 1.53E-09 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610191856 | NA | 8.27E-06 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610191856 | NA | 3.07E-08 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610191856 | 1.05E-06 | NA | mr1695_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610191856 | 6.77E-06 | NA | mr1695_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610191856 | NA | 2.46E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |