\
| Variant ID: vg0610143043 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10143043 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATATAAGATTAGGTGATGAGATAGAGAAGAGAAATTAGGAGAGAGAATGAACCACCCCCTCATTCATGGGGCAACCTCAACACAATCTCCAAGAAAAATA[T/C]
AAAATGATATGAGAGCAAACTCATATTGAAGTTTGTAGATTGGTTATGATATTTGTGTCTGTTACTTCTTAATTAATGAGAAGATAAAATGGTTTAAATG
CATTTAAACCATTTTATCTTCTCATTAATTAAGAAGTAACAGACACAAATATCATAACCAATCTACAAACTTCAATATGAGTTTGCTCTCATATCATTTT[A/G]
TATTTTTCTTGGAGATTGTGTTGAGGTTGCCCCATGAATGAGGGGGTGGTTCATTCTCTCTCCTAATTTCTCTTCTCTATCTCATCACCTAATCTTATAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.20% | 26.10% | 3.58% | 3.07% | NA |
| All Indica | 2759 | 57.70% | 31.60% | 5.62% | 5.11% | NA |
| All Japonica | 1512 | 80.40% | 19.00% | 0.46% | 0.07% | NA |
| Aus | 269 | 85.10% | 14.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 67.20% | 16.80% | 6.22% | 9.75% | NA |
| Indica II | 465 | 62.20% | 11.60% | 16.13% | 10.11% | NA |
| Indica III | 913 | 49.80% | 48.60% | 1.20% | 0.33% | NA |
| Indica Intermediate | 786 | 57.00% | 34.70% | 4.07% | 4.20% | NA |
| Temperate Japonica | 767 | 84.20% | 15.30% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 73.20% | 26.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.40% | 15.40% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 22.20% | 6.67% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610143043 | T -> C | LOC_Os06g17490.1 | upstream_gene_variant ; 3798.0bp to feature; MODIFIER | silent_mutation | Average:41.276; most accessible tissue: Callus, score: 74.036 | N | N | N | N |
| vg0610143043 | T -> C | LOC_Os06g17480.1 | downstream_gene_variant ; 4168.0bp to feature; MODIFIER | silent_mutation | Average:41.276; most accessible tissue: Callus, score: 74.036 | N | N | N | N |
| vg0610143043 | T -> C | LOC_Os06g17480-LOC_Os06g17490 | intergenic_region ; MODIFIER | silent_mutation | Average:41.276; most accessible tissue: Callus, score: 74.036 | N | N | N | N |
| vg0610143043 | T -> DEL | N | N | silent_mutation | Average:41.276; most accessible tissue: Callus, score: 74.036 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610143043 | 2.21E-14 | 4.45E-24 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.56E-09 | 1.01E-14 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 7.73E-09 | 2.83E-14 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 8.04E-09 | 4.51E-12 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 5.83E-15 | 2.41E-18 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | NA | 1.15E-06 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.08E-08 | NA | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 8.92E-18 | 9.37E-31 | mr1091 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 3.01E-09 | 7.95E-18 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 5.97E-11 | 6.25E-19 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | NA | 7.25E-07 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.13E-14 | 6.33E-24 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 3.87E-10 | 1.78E-18 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 6.16E-07 | 3.28E-12 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 6.91E-13 | 2.79E-22 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 2.42E-08 | 3.24E-13 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.08E-08 | 2.54E-14 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 3.09E-06 | 2.17E-09 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | NA | 8.37E-07 | mr1215 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 2.84E-08 | 1.87E-12 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 9.12E-07 | 2.41E-10 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 4.48E-07 | NA | mr1234 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 8.38E-16 | 1.83E-26 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 8.27E-07 | 1.27E-11 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | NA | 4.10E-10 | mr1244 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | NA | 5.30E-08 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 3.75E-08 | 5.41E-12 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 7.29E-06 | NA | mr1571 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 2.58E-08 | 1.98E-12 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 2.73E-07 | 4.30E-11 | mr1695 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 7.63E-07 | 7.63E-07 | mr1850 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 4.45E-09 | 1.49E-14 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.27E-06 | NA | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 3.03E-17 | 5.19E-28 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 6.37E-13 | 9.27E-17 | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 4.80E-11 | 5.24E-17 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 4.15E-12 | 2.32E-13 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 9.54E-17 | 1.19E-18 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.03E-06 | 1.83E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 2.33E-10 | NA | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.26E-20 | 1.38E-34 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 5.01E-09 | 1.45E-17 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.35E-10 | 1.02E-18 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 3.02E-08 | NA | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.49E-18 | 8.96E-27 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 3.05E-09 | NA | mr1110_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.19E-17 | 3.93E-26 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 8.95E-10 | 2.91E-14 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.51E-09 | NA | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.02E-19 | 1.73E-31 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 2.03E-10 | 2.16E-15 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 2.96E-09 | 1.37E-14 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.08E-07 | 5.37E-12 | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | NA | 1.03E-07 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 6.87E-06 | NA | mr1218_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.55E-09 | 4.82E-21 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | NA | 6.52E-07 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 6.35E-12 | 2.32E-21 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.42E-10 | NA | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 9.40E-19 | 1.48E-27 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | NA | 1.36E-10 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | NA | 3.99E-06 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 5.10E-06 | 1.11E-11 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 2.25E-11 | 3.44E-13 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 6.32E-06 | NA | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 1.28E-07 | 5.22E-15 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 4.73E-06 | NA | mr1695_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 5.76E-10 | 8.04E-09 | mr1695_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 4.39E-08 | NA | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | 2.87E-09 | 1.07E-16 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610143043 | NA | 3.60E-10 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |