Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610137001:

Variant ID: vg0610137001 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10137001
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

TAAATTCTTATATTTTGGGATGGAAAGAGTATATGTTAAATATATGTTGTTTTAGTTTTAATTTTGAATTTTTTGTGAAGTATAAGTCATTTGAAGAAAA[A/G]
ACCTTTTCATCTTTTCTTACTGGTTTATTTTACCAATCAATCAATTGTTCTCAAGCTGGCAGTTTTGCCAGTTGTTGATTGGACCACGTGGCTTGACAAT

Reverse complement sequence

ATTGTCAAGCCACGTGGTCCAATCAACAACTGGCAAAACTGCCAGCTTGAGAACAATTGATTGATTGGTAAAATAAACCAGTAAGAAAAGATGAAAAGGT[T/C]
TTTTCTTCAAATGACTTATACTTCACAAAAAATTCAAAATTAAAACTAAAACAACATATATTTAACATATACTCTTTCCATCCCAAAATATAAGAATTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.40%	28.60%	0.02%	0.00%	NA
All Indica	2759	56.10%	43.90%	0.04%	0.00%	NA
All Japonica	1512	93.30%	6.70%	0.00%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	79.30%	20.70%	0.00%	0.00%	NA
Indica II	465	17.20%	82.80%	0.00%	0.00%	NA
Indica III	913	61.70%	38.20%	0.11%	0.00%	NA
Indica Intermediate	786	55.00%	45.00%	0.00%	0.00%	NA
Temperate Japonica	767	94.90%	5.10%	0.00%	0.00%	NA
Tropical Japonica	504	90.10%	9.90%	0.00%	0.00%	NA
Japonica Intermediate	241	94.60%	5.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	61.10%	38.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610137001	A -> G	LOC_Os06g17470.1	upstream_gene_variant ; 1393.0bp to feature; MODIFIER	silent_mutation	Average:38.036; most accessible tissue: Callus, score: 80.629	N	N	N	N
vg0610137001	A -> G	LOC_Os06g17480.1	upstream_gene_variant ; 822.0bp to feature; MODIFIER	silent_mutation	Average:38.036; most accessible tissue: Callus, score: 80.629	N	N	N	N
vg0610137001	A -> G	LOC_Os06g17470-LOC_Os06g17480	intergenic_region ; MODIFIER	silent_mutation	Average:38.036; most accessible tissue: Callus, score: 80.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610137001	NA	4.38E-08	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	1.59E-06	NA	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	4.01E-06	1.21E-11	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	7.52E-06	NA	mr1096	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	8.44E-06	NA	mr1111	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	NA	3.84E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	3.88E-06	NA	mr1144	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	NA	9.04E-07	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	1.38E-06	NA	mr1695	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	1.92E-06	NA	mr1695	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	6.86E-06	NA	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	2.55E-09	NA	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	6.97E-09	1.21E-08	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	5.61E-07	NA	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	5.12E-08	NA	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	5.05E-08	NA	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	6.09E-10	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	8.27E-10	2.40E-14	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	5.93E-07	NA	mr1091_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	3.51E-06	NA	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	9.32E-06	NA	mr1094_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	NA	5.01E-07	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	2.22E-07	NA	mr1096_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	NA	1.52E-06	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	8.98E-06	NA	mr1108_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	4.46E-06	NA	mr1110_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	3.27E-09	NA	mr1111_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	6.51E-09	1.94E-06	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	1.70E-06	NA	mr1112_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	4.71E-07	NA	mr1121_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	1.15E-06	3.14E-08	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	1.66E-08	NA	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	3.45E-08	3.90E-07	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	1.73E-06	NA	mr1200_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	4.38E-07	NA	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	1.52E-06	NA	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	3.46E-07	1.75E-10	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	NA	2.52E-06	mr1221_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	1.67E-06	NA	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	6.56E-06	NA	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	5.35E-07	NA	mr1695_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	1.92E-06	NA	mr1695_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610137001	NA	4.72E-06	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251