Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610136119:

Variant ID: vg0610136119 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10136119
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTCCCGGTTGATAACAACAACCGGGATAGGATCTTTAGTCCCGGTTTTTTCAACCGGGACTAAAGACATCTTTAGTCCCGAATTGTTACTCCCGGTTG[G/A]
AAACCCGGGACTAAAAGGGGTTACTAACCGGGAGTAAAAAGGTTTCTCTACTGGTGCACTCATCGACTCGCCATTGATTCTACGTAAAGAAACTGCTATT

Reverse complement sequence

AATAGCAGTTTCTTTACGTAGAATCAATGGCGAGTCGATGAGTGCACCAGTAGAGAAACCTTTTTACTCCCGGTTAGTAACCCCTTTTAGTCCCGGGTTT[C/T]
CAACCGGGAGTAACAATTCGGGACTAAAGATGTCTTTAGTCCCGGTTGAAAAAACCGGGACTAAAGATCCTATCCCGGTTGTTGTTATCAACCGGGACTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.80%	12.00%	0.21%	0.00%	NA
All Indica	2759	87.30%	12.50%	0.22%	0.00%	NA
All Japonica	1512	87.00%	13.00%	0.00%	0.00%	NA
Aus	269	98.10%	0.70%	1.12%	0.00%	NA
Indica I	595	87.40%	12.60%	0.00%	0.00%	NA
Indica II	465	89.90%	10.10%	0.00%	0.00%	NA
Indica III	913	85.00%	14.60%	0.44%	0.00%	NA
Indica Intermediate	786	88.40%	11.30%	0.25%	0.00%	NA
Temperate Japonica	767	96.20%	3.80%	0.00%	0.00%	NA
Tropical Japonica	504	73.60%	26.40%	0.00%	0.00%	NA
Japonica Intermediate	241	85.50%	14.50%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610136119	G -> A	LOC_Os06g17470.1	upstream_gene_variant ; 511.0bp to feature; MODIFIER	silent_mutation	Average:36.159; most accessible tissue: Zhenshan97 young leaf, score: 51.997	N	N	N	N
vg0610136119	G -> A	LOC_Os06g17480.1	upstream_gene_variant ; 1704.0bp to feature; MODIFIER	silent_mutation	Average:36.159; most accessible tissue: Zhenshan97 young leaf, score: 51.997	N	N	N	N
vg0610136119	G -> A	LOC_Os06g17460.1	downstream_gene_variant ; 4315.0bp to feature; MODIFIER	silent_mutation	Average:36.159; most accessible tissue: Zhenshan97 young leaf, score: 51.997	N	N	N	N
vg0610136119	G -> A	LOC_Os06g17470-LOC_Os06g17480	intergenic_region ; MODIFIER	silent_mutation	Average:36.159; most accessible tissue: Zhenshan97 young leaf, score: 51.997	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610136119	2.63E-08	2.63E-08	mr1068	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	3.40E-06	3.57E-07	mr1078	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	NA	7.47E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	1.90E-06	9.85E-09	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	NA	1.26E-06	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	6.00E-08	6.00E-08	mr1110	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	NA	4.28E-08	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	NA	1.08E-06	mr1211	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	6.20E-07	NA	mr1695	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	8.92E-13	1.05E-13	mr1695	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	NA	1.11E-07	mr1068_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	NA	1.88E-06	mr1078_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	8.79E-06	6.96E-09	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	NA	1.21E-06	mr1094_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	NA	2.95E-07	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	NA	1.48E-07	mr1110_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	NA	2.17E-08	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	NA	2.22E-06	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	NA	1.68E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	2.58E-06	NA	mr1165_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	3.25E-06	5.82E-09	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	9.42E-06	1.01E-09	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	NA	1.32E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	3.08E-07	NA	mr1695_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	1.10E-13	3.90E-10	mr1695_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	4.38E-08	NA	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119	NA	1.28E-08	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251