Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610136119:

Variant ID: vg0610136119 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10136119
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTCCCGGTTGATAACAACAACCGGGATAGGATCTTTAGTCCCGGTTTTTTCAACCGGGACTAAAGACATCTTTAGTCCCGAATTGTTACTCCCGGTTG[G/A]
AAACCCGGGACTAAAAGGGGTTACTAACCGGGAGTAAAAAGGTTTCTCTACTGGTGCACTCATCGACTCGCCATTGATTCTACGTAAAGAAACTGCTATT

Reverse complement sequence

AATAGCAGTTTCTTTACGTAGAATCAATGGCGAGTCGATGAGTGCACCAGTAGAGAAACCTTTTTACTCCCGGTTAGTAACCCCTTTTAGTCCCGGGTTT[C/T]
CAACCGGGAGTAACAATTCGGGACTAAAGATGTCTTTAGTCCCGGTTGAAAAAACCGGGACTAAAGATCCTATCCCGGTTGTTGTTATCAACCGGGACTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 12.00% 0.21% 0.00% NA
All Indica  2759 87.30% 12.50% 0.22% 0.00% NA
All Japonica  1512 87.00% 13.00% 0.00% 0.00% NA
Aus  269 98.10% 0.70% 1.12% 0.00% NA
Indica I  595 87.40% 12.60% 0.00% 0.00% NA
Indica II  465 89.90% 10.10% 0.00% 0.00% NA
Indica III  913 85.00% 14.60% 0.44% 0.00% NA
Indica Intermediate  786 88.40% 11.30% 0.25% 0.00% NA
Temperate Japonica  767 96.20% 3.80% 0.00% 0.00% NA
Tropical Japonica  504 73.60% 26.40% 0.00% 0.00% NA
Japonica Intermediate  241 85.50% 14.50% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610136119 G -> A LOC_Os06g17470.1 upstream_gene_variant ; 511.0bp to feature; MODIFIER silent_mutation Average:36.159; most accessible tissue: Zhenshan97 young leaf, score: 51.997 N N N N
vg0610136119 G -> A LOC_Os06g17480.1 upstream_gene_variant ; 1704.0bp to feature; MODIFIER silent_mutation Average:36.159; most accessible tissue: Zhenshan97 young leaf, score: 51.997 N N N N
vg0610136119 G -> A LOC_Os06g17460.1 downstream_gene_variant ; 4315.0bp to feature; MODIFIER silent_mutation Average:36.159; most accessible tissue: Zhenshan97 young leaf, score: 51.997 N N N N
vg0610136119 G -> A LOC_Os06g17470-LOC_Os06g17480 intergenic_region ; MODIFIER silent_mutation Average:36.159; most accessible tissue: Zhenshan97 young leaf, score: 51.997 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610136119 2.63E-08 2.63E-08 mr1068 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 3.40E-06 3.57E-07 mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 NA 7.47E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 1.90E-06 9.85E-09 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 NA 1.26E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 6.00E-08 6.00E-08 mr1110 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 NA 4.28E-08 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 NA 1.08E-06 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 6.20E-07 NA mr1695 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 8.92E-13 1.05E-13 mr1695 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 NA 1.11E-07 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 NA 1.88E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 8.79E-06 6.96E-09 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 NA 1.21E-06 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 NA 2.95E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 NA 1.48E-07 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 NA 2.17E-08 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 NA 2.22E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 NA 1.68E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 2.58E-06 NA mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 3.25E-06 5.82E-09 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 9.42E-06 1.01E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 NA 1.32E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 3.08E-07 NA mr1695_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 1.10E-13 3.90E-10 mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 4.38E-08 NA mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610136119 NA 1.28E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251