\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610135032:

Variant ID: vg0610135032 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 10135032
Reference Allele: AAlternative Allele: T,ATAATCTT
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, A: 0.27, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGCATACCTGTCCGCAGTCATGCGCCAGCGTCCAGCGAACCCGAACAACATGCCCAGGGGTACGGTCAACTCAACCACCACTACTAGAGAAATAATCG[A/T,ATAATCTT]
TGCTCGGTCAGCTGATTTCCACAATACTCACGGTTCTAGTAAAAACCAGGACTAAAAATTATTTTTAGTCTCGGTTATAAAAATTTTGATCTTTGGTGGG

Reverse complement sequence

CCCACCAAAGATCAAAATTTTTATAACCGAGACTAAAAATAATTTTTAGTCCTGGTTTTTACTAGAACCGTGAGTATTGTGGAAATCAGCTGACCGAGCA[T/A,AAGATTAT]
CGATTATTTCTCTAGTAGTGGTGGTTGAGTTGACCGTACCCCTGGGCATGTTGTTCGGGTTCGCTGGACGCTGGCGCATGACTGCGGACAGGTATGCTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 42.70% 0.06% 0.00% ATAATCTT: 1.38%
All Indica  2759 74.30% 24.90% 0.04% 0.00% ATAATCTT: 0.83%
All Japonica  1512 33.50% 66.30% 0.13% 0.00% NA
Aus  269 3.30% 81.80% 0.00% 0.00% ATAATCTT: 14.87%
Indica I  595 37.30% 62.70% 0.00% 0.00% NA
Indica II  465 94.00% 5.60% 0.22% 0.00% ATAATCTT: 0.22%
Indica III  913 84.80% 13.10% 0.00% 0.00% ATAATCTT: 2.08%
Indica Intermediate  786 78.40% 21.20% 0.00% 0.00% ATAATCTT: 0.38%
Temperate Japonica  767 34.60% 65.20% 0.26% 0.00% NA
Tropical Japonica  504 36.70% 63.30% 0.00% 0.00% NA
Japonica Intermediate  241 23.70% 76.30% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 79.20% 0.00% 0.00% ATAATCTT: 2.08%
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610135032 A -> T LOC_Os06g17480.1 upstream_gene_variant ; 2791.0bp to feature; MODIFIER silent_mutation Average:53.787; most accessible tissue: Callus, score: 85.339 N N N N
vg0610135032 A -> T LOC_Os06g17460.1 downstream_gene_variant ; 3228.0bp to feature; MODIFIER silent_mutation Average:53.787; most accessible tissue: Callus, score: 85.339 N N N N
vg0610135032 A -> T LOC_Os06g17470.1 downstream_gene_variant ; 136.0bp to feature; MODIFIER silent_mutation Average:53.787; most accessible tissue: Callus, score: 85.339 N N N N
vg0610135032 A -> T LOC_Os06g17460-LOC_Os06g17470 intergenic_region ; MODIFIER silent_mutation Average:53.787; most accessible tissue: Callus, score: 85.339 N N N N
vg0610135032 A -> ATAATCTT LOC_Os06g17480.1 upstream_gene_variant ; 2790.0bp to feature; MODIFIER silent_mutation Average:53.787; most accessible tissue: Callus, score: 85.339 N N N N
vg0610135032 A -> ATAATCTT LOC_Os06g17460.1 downstream_gene_variant ; 3229.0bp to feature; MODIFIER silent_mutation Average:53.787; most accessible tissue: Callus, score: 85.339 N N N N
vg0610135032 A -> ATAATCTT LOC_Os06g17470.1 downstream_gene_variant ; 135.0bp to feature; MODIFIER silent_mutation Average:53.787; most accessible tissue: Callus, score: 85.339 N N N N
vg0610135032 A -> ATAATCTT LOC_Os06g17460-LOC_Os06g17470 intergenic_region ; MODIFIER silent_mutation Average:53.787; most accessible tissue: Callus, score: 85.339 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610135032 NA 2.15E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 NA 2.23E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 2.72E-06 NA mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 NA 4.01E-07 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 NA 6.65E-09 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 NA 3.27E-09 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 NA 7.90E-07 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 NA 3.49E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 NA 3.26E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 6.68E-06 NA mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 1.06E-06 1.30E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 NA 6.34E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 4.34E-07 6.18E-12 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 7.05E-06 NA mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 NA 1.22E-07 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 7.29E-07 2.28E-11 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 NA 7.94E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 1.57E-06 NA mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610135032 2.53E-07 1.04E-11 mr1850_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251