\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610132375:

Variant ID: vg0610132375 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10132375
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.37, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATTCGTACATATAAAGTTGTCACATTATATTGTGTCATTTAAAAAAAAGACAAATGTAATAAACTTATATGTGCCTTTTTTTAAAAAAAAAAAAATC[G/A]
GCACCCTAATCTGCTAAGCCGAGCCTCACCTCATTTGGTCAAACCTCCGTCCTTATCCTTTGTCTCTGTTGGTTCGTCATTATCATTTTTCCATTCCCCT

Reverse complement sequence

AGGGGAATGGAAAAATGATAATGACGAACCAACAGAGACAAAGGATAAGGACGGAGGTTTGACCAAATGAGGTGAGGCTCGGCTTAGCAGATTAGGGTGC[C/T]
GATTTTTTTTTTTTTAAAAAAAGGCACATATAAGTTTATTACATTTGTCTTTTTTTTAAATGACACAATATAATGTGACAACTTTATATGTACGAATTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 31.90% 0.11% 0.00% NA
All Indica  2759 50.60% 49.30% 0.11% 0.00% NA
All Japonica  1512 92.90% 7.00% 0.07% 0.00% NA
Aus  269 97.80% 1.90% 0.37% 0.00% NA
Indica I  595 79.30% 20.50% 0.17% 0.00% NA
Indica II  465 16.60% 83.20% 0.22% 0.00% NA
Indica III  913 50.30% 49.70% 0.00% 0.00% NA
Indica Intermediate  786 49.20% 50.60% 0.13% 0.00% NA
Temperate Japonica  767 94.80% 5.20% 0.00% 0.00% NA
Tropical Japonica  504 90.10% 9.90% 0.00% 0.00% NA
Japonica Intermediate  241 92.90% 6.60% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610132375 G -> A LOC_Os06g17450.1 downstream_gene_variant ; 4963.0bp to feature; MODIFIER silent_mutation Average:70.37; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg0610132375 G -> A LOC_Os06g17460.1 downstream_gene_variant ; 571.0bp to feature; MODIFIER silent_mutation Average:70.37; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg0610132375 G -> A LOC_Os06g17470.1 downstream_gene_variant ; 2793.0bp to feature; MODIFIER silent_mutation Average:70.37; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg0610132375 G -> A LOC_Os06g17460-LOC_Os06g17470 intergenic_region ; MODIFIER silent_mutation Average:70.37; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610132375 1.61E-06 NA mr1695 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375 3.97E-08 3.23E-06 mr1695 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375 NA 1.16E-06 mr1857 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375 1.16E-06 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375 7.12E-07 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375 NA 2.25E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375 NA 5.89E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375 NA 3.56E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375 NA 1.42E-07 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251