Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610132375:

Variant ID: vg0610132375 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10132375
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.37, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATTCGTACATATAAAGTTGTCACATTATATTGTGTCATTTAAAAAAAAGACAAATGTAATAAACTTATATGTGCCTTTTTTTAAAAAAAAAAAAATC[G/A]
GCACCCTAATCTGCTAAGCCGAGCCTCACCTCATTTGGTCAAACCTCCGTCCTTATCCTTTGTCTCTGTTGGTTCGTCATTATCATTTTTCCATTCCCCT

Reverse complement sequence

AGGGGAATGGAAAAATGATAATGACGAACCAACAGAGACAAAGGATAAGGACGGAGGTTTGACCAAATGAGGTGAGGCTCGGCTTAGCAGATTAGGGTGC[C/T]
GATTTTTTTTTTTTTAAAAAAAGGCACATATAAGTTTATTACATTTGTCTTTTTTTTAAATGACACAATATAATGTGACAACTTTATATGTACGAATTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.00%	31.90%	0.11%	0.00%	NA
All Indica	2759	50.60%	49.30%	0.11%	0.00%	NA
All Japonica	1512	92.90%	7.00%	0.07%	0.00%	NA
Aus	269	97.80%	1.90%	0.37%	0.00%	NA
Indica I	595	79.30%	20.50%	0.17%	0.00%	NA
Indica II	465	16.60%	83.20%	0.22%	0.00%	NA
Indica III	913	50.30%	49.70%	0.00%	0.00%	NA
Indica Intermediate	786	49.20%	50.60%	0.13%	0.00%	NA
Temperate Japonica	767	94.80%	5.20%	0.00%	0.00%	NA
Tropical Japonica	504	90.10%	9.90%	0.00%	0.00%	NA
Japonica Intermediate	241	92.90%	6.60%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	61.10%	38.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610132375	G -> A	LOC_Os06g17450.1	downstream_gene_variant ; 4963.0bp to feature; MODIFIER	silent_mutation	Average:70.37; most accessible tissue: Zhenshan97 panicle, score: 88.35	N	N	N	N
vg0610132375	G -> A	LOC_Os06g17460.1	downstream_gene_variant ; 571.0bp to feature; MODIFIER	silent_mutation	Average:70.37; most accessible tissue: Zhenshan97 panicle, score: 88.35	N	N	N	N
vg0610132375	G -> A	LOC_Os06g17470.1	downstream_gene_variant ; 2793.0bp to feature; MODIFIER	silent_mutation	Average:70.37; most accessible tissue: Zhenshan97 panicle, score: 88.35	N	N	N	N
vg0610132375	G -> A	LOC_Os06g17460-LOC_Os06g17470	intergenic_region ; MODIFIER	silent_mutation	Average:70.37; most accessible tissue: Zhenshan97 panicle, score: 88.35	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610132375	1.61E-06	NA	mr1695	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375	3.97E-08	3.23E-06	mr1695	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375	NA	1.16E-06	mr1857	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375	1.16E-06	NA	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375	7.12E-07	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375	NA	2.25E-06	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375	NA	5.89E-06	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375	NA	3.56E-06	mr1928_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610132375	NA	1.42E-07	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251