\
| Variant ID: vg0610132375 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10132375 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.37, others allele: 0.00, population size: 99. )
AAAATTCGTACATATAAAGTTGTCACATTATATTGTGTCATTTAAAAAAAAGACAAATGTAATAAACTTATATGTGCCTTTTTTTAAAAAAAAAAAAATC[G/A]
GCACCCTAATCTGCTAAGCCGAGCCTCACCTCATTTGGTCAAACCTCCGTCCTTATCCTTTGTCTCTGTTGGTTCGTCATTATCATTTTTCCATTCCCCT
AGGGGAATGGAAAAATGATAATGACGAACCAACAGAGACAAAGGATAAGGACGGAGGTTTGACCAAATGAGGTGAGGCTCGGCTTAGCAGATTAGGGTGC[C/T]
GATTTTTTTTTTTTTAAAAAAAGGCACATATAAGTTTATTACATTTGTCTTTTTTTTAAATGACACAATATAATGTGACAACTTTATATGTACGAATTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.00% | 31.90% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 50.60% | 49.30% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 92.90% | 7.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 97.80% | 1.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 79.30% | 20.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 16.60% | 83.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 50.30% | 49.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 49.20% | 50.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 6.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 38.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610132375 | G -> A | LOC_Os06g17450.1 | downstream_gene_variant ; 4963.0bp to feature; MODIFIER | silent_mutation | Average:70.37; most accessible tissue: Zhenshan97 panicle, score: 88.35 | N | N | N | N |
| vg0610132375 | G -> A | LOC_Os06g17460.1 | downstream_gene_variant ; 571.0bp to feature; MODIFIER | silent_mutation | Average:70.37; most accessible tissue: Zhenshan97 panicle, score: 88.35 | N | N | N | N |
| vg0610132375 | G -> A | LOC_Os06g17470.1 | downstream_gene_variant ; 2793.0bp to feature; MODIFIER | silent_mutation | Average:70.37; most accessible tissue: Zhenshan97 panicle, score: 88.35 | N | N | N | N |
| vg0610132375 | G -> A | LOC_Os06g17460-LOC_Os06g17470 | intergenic_region ; MODIFIER | silent_mutation | Average:70.37; most accessible tissue: Zhenshan97 panicle, score: 88.35 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610132375 | 1.61E-06 | NA | mr1695 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610132375 | 3.97E-08 | 3.23E-06 | mr1695 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610132375 | NA | 1.16E-06 | mr1857 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610132375 | 1.16E-06 | NA | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610132375 | 7.12E-07 | NA | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610132375 | NA | 2.25E-06 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610132375 | NA | 5.89E-06 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610132375 | NA | 3.56E-06 | mr1928_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610132375 | NA | 1.42E-07 | mr1931_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |