Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610128100:

Variant ID: vg0610128100 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10128100
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

GATAAAACTAATTTAGTATTACTATATTTGTCTATACAATTTGTCAAACTTAAAACAATTTGATTCTGACCATAGTCAAAACGTCTTATAACCTGAAACG[G/A]
AGGAAGTAGCTAACAATTGGATTGTTTGGGTAAGCTGAAGATTATGTGGGAAGCTATAGTTGATAGAAGCTCCTCCAAATGATCCCTAAGTTTTCATTCT

Reverse complement sequence

AGAATGAAAACTTAGGGATCATTTGGAGGAGCTTCTATCAACTATAGCTTCCCACATAATCTTCAGCTTACCCAAACAATCCAATTGTTAGCTACTTCCT[C/T]
CGTTTCAGGTTATAAGACGTTTTGACTATGGTCAGAATCAAATTGTTTTAAGTTTGACAAATTGTATAGACAAATATAGTAATACTAAATTAGTTTTATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.90%	7.40%	0.42%	24.19%	NA
All Indica	2759	55.70%	7.20%	0.40%	36.72%	NA
All Japonica	1512	84.90%	8.40%	0.46%	6.28%	NA
Aus	269	98.50%	0.00%	0.00%	1.49%	NA
Indica I	595	82.70%	1.80%	0.00%	15.46%	NA
Indica II	465	10.10%	8.40%	0.43%	81.08%	NA
Indica III	913	62.10%	12.00%	0.33%	25.52%	NA
Indica Intermediate	786	54.80%	4.80%	0.76%	39.57%	NA
Temperate Japonica	767	80.10%	14.90%	0.65%	4.43%	NA
Tropical Japonica	504	89.50%	0.60%	0.40%	9.52%	NA
Japonica Intermediate	241	90.50%	4.10%	0.00%	5.39%	NA
VI/Aromatic	96	77.10%	22.90%	0.00%	0.00%	NA
Intermediate	90	57.80%	5.60%	2.22%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610128100	G -> A	LOC_Os06g17460.1	upstream_gene_variant ; 2933.0bp to feature; MODIFIER	silent_mutation	Average:21.344; most accessible tissue: Callus, score: 66.753	N	N	N	N
vg0610128100	G -> A	LOC_Os06g17440.1	downstream_gene_variant ; 3678.0bp to feature; MODIFIER	silent_mutation	Average:21.344; most accessible tissue: Callus, score: 66.753	N	N	N	N
vg0610128100	G -> A	LOC_Os06g17450.1	downstream_gene_variant ; 688.0bp to feature; MODIFIER	silent_mutation	Average:21.344; most accessible tissue: Callus, score: 66.753	N	N	N	N
vg0610128100	G -> A	LOC_Os06g17450-LOC_Os06g17460	intergenic_region ; MODIFIER	silent_mutation	Average:21.344; most accessible tissue: Callus, score: 66.753	N	N	N	N
vg0610128100	G -> DEL	N	N	silent_mutation	Average:21.344; most accessible tissue: Callus, score: 66.753	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610128100	1.42E-12	NA	mr1695	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610128100	1.87E-06	NA	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610128100	6.77E-06	NA	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610128100	4.76E-06	NA	mr1200_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610128100	2.71E-16	NA	mr1695_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610128100	NA	4.11E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251