\
| Variant ID: vg0610128100 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10128100 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 113. )
GATAAAACTAATTTAGTATTACTATATTTGTCTATACAATTTGTCAAACTTAAAACAATTTGATTCTGACCATAGTCAAAACGTCTTATAACCTGAAACG[G/A]
AGGAAGTAGCTAACAATTGGATTGTTTGGGTAAGCTGAAGATTATGTGGGAAGCTATAGTTGATAGAAGCTCCTCCAAATGATCCCTAAGTTTTCATTCT
AGAATGAAAACTTAGGGATCATTTGGAGGAGCTTCTATCAACTATAGCTTCCCACATAATCTTCAGCTTACCCAAACAATCCAATTGTTAGCTACTTCCT[C/T]
CGTTTCAGGTTATAAGACGTTTTGACTATGGTCAGAATCAAATTGTTTTAAGTTTGACAAATTGTATAGACAAATATAGTAATACTAAATTAGTTTTATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.90% | 7.40% | 0.42% | 24.19% | NA |
| All Indica | 2759 | 55.70% | 7.20% | 0.40% | 36.72% | NA |
| All Japonica | 1512 | 84.90% | 8.40% | 0.46% | 6.28% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.00% | 1.49% | NA |
| Indica I | 595 | 82.70% | 1.80% | 0.00% | 15.46% | NA |
| Indica II | 465 | 10.10% | 8.40% | 0.43% | 81.08% | NA |
| Indica III | 913 | 62.10% | 12.00% | 0.33% | 25.52% | NA |
| Indica Intermediate | 786 | 54.80% | 4.80% | 0.76% | 39.57% | NA |
| Temperate Japonica | 767 | 80.10% | 14.90% | 0.65% | 4.43% | NA |
| Tropical Japonica | 504 | 89.50% | 0.60% | 0.40% | 9.52% | NA |
| Japonica Intermediate | 241 | 90.50% | 4.10% | 0.00% | 5.39% | NA |
| VI/Aromatic | 96 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 5.60% | 2.22% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610128100 | G -> A | LOC_Os06g17460.1 | upstream_gene_variant ; 2933.0bp to feature; MODIFIER | silent_mutation | Average:21.344; most accessible tissue: Callus, score: 66.753 | N | N | N | N |
| vg0610128100 | G -> A | LOC_Os06g17440.1 | downstream_gene_variant ; 3678.0bp to feature; MODIFIER | silent_mutation | Average:21.344; most accessible tissue: Callus, score: 66.753 | N | N | N | N |
| vg0610128100 | G -> A | LOC_Os06g17450.1 | downstream_gene_variant ; 688.0bp to feature; MODIFIER | silent_mutation | Average:21.344; most accessible tissue: Callus, score: 66.753 | N | N | N | N |
| vg0610128100 | G -> A | LOC_Os06g17450-LOC_Os06g17460 | intergenic_region ; MODIFIER | silent_mutation | Average:21.344; most accessible tissue: Callus, score: 66.753 | N | N | N | N |
| vg0610128100 | G -> DEL | N | N | silent_mutation | Average:21.344; most accessible tissue: Callus, score: 66.753 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610128100 | 1.42E-12 | NA | mr1695 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610128100 | 1.87E-06 | NA | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610128100 | 6.77E-06 | NA | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610128100 | 4.76E-06 | NA | mr1200_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610128100 | 2.71E-16 | NA | mr1695_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610128100 | NA | 4.11E-06 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |