Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0610126409:

Variant ID: vg0610126409 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10126409
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTGACTTAAAAGTTTTCAATATTGACTTCTACTCCTACACGCGTGCAGTAGTGTAACGGCGAAAAGAAAAAAAAAGAAACACGACAGCTGTGAAAAAA[G/T]
AAGAAAAAAGAAACGGGCGCGCTTGGACGTACGAGGGCCCGCCACGTGGCACGCGCCTGAGACTTGGAAAAGTCGCACTTACGTGCTAATTAGCAAAACC

Reverse complement sequence

GGTTTTGCTAATTAGCACGTAAGTGCGACTTTTCCAAGTCTCAGGCGCGTGCCACGTGGCGGGCCCTCGTACGTCCAAGCGCGCCCGTTTCTTTTTTCTT[C/A]
TTTTTTCACAGCTGTCGTGTTTCTTTTTTTTTCTTTTCGCCGTTACACTACTGCACGCGTGTAGGAGTAGAAGTCAATATTGAAAACTTTTAAGTCAAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.90% 6.10% 0.02% 0.00% NA
All Indica  2759 89.60% 10.30% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 81.80% 18.10% 0.11% 0.00% NA
Indica Intermediate  786 85.60% 14.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610126409 G -> T LOC_Os06g17450.1 upstream_gene_variant ; 339.0bp to feature; MODIFIER silent_mutation Average:84.108; most accessible tissue: Minghui63 root, score: 93.523 N N N N
vg0610126409 G -> T LOC_Os06g17460.1 upstream_gene_variant ; 4624.0bp to feature; MODIFIER silent_mutation Average:84.108; most accessible tissue: Minghui63 root, score: 93.523 N N N N
vg0610126409 G -> T LOC_Os06g17440.1 downstream_gene_variant ; 1987.0bp to feature; MODIFIER silent_mutation Average:84.108; most accessible tissue: Minghui63 root, score: 93.523 N N N N
vg0610126409 G -> T LOC_Os06g17440-LOC_Os06g17450 intergenic_region ; MODIFIER silent_mutation Average:84.108; most accessible tissue: Minghui63 root, score: 93.523 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0610126409 G T -0.04 -0.05 -0.07 -0.14 -0.14 -0.14

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610126409 NA 3.49E-08 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610126409 NA 1.94E-08 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610126409 NA 1.67E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610126409 NA 7.42E-09 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610126409 NA 2.45E-11 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610126409 NA 2.17E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610126409 NA 3.75E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610126409 NA 5.20E-07 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610126409 NA 9.44E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610126409 NA 1.38E-07 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610126409 NA 1.76E-06 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610126409 NA 2.24E-08 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610126409 NA 2.02E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610126409 6.96E-07 2.35E-13 mr1244_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251