Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610115996:

Variant ID: vg0610115996 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10115996
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.08, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

GCATATGCCCAAGGGGGACGACTTTGCCGTAGCAAGTTGAGCCCCGGAAAGACCGAAGAAGCTTACCGAAGAAGCTATCCTGGCCCATCAAGCCTAATGG[C/A]
TAATTGGGCTGACAATCGCCTAACGGCCCGTTAGGGGCCCACGAACCTCAATTACACTATATACCCATGTAAATGTCCCTTTCATAAGGGCAACCATGTA

Reverse complement sequence

TACATGGTTGCCCTTATGAAAGGGACATTTACATGGGTATATAGTGTAATTGAGGTTCGTGGGCCCCTAACGGGCCGTTAGGCGATTGTCAGCCCAATTA[G/T]
CCATTAGGCTTGATGGGCCAGGATAGCTTCTTCGGTAAGCTTCTTCGGTCTTTCCGGGGCTCAACTTGCTACGGCAAAGTCGTCCCCCTTGGGCATATGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.10%	32.10%	0.25%	0.51%	NA
All Indica	2759	50.40%	49.50%	0.11%	0.00%	NA
All Japonica	1512	91.50%	6.50%	0.40%	1.52%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	79.30%	20.70%	0.00%	0.00%	NA
Indica II	465	8.20%	91.60%	0.22%	0.00%	NA
Indica III	913	53.20%	46.80%	0.00%	0.00%	NA
Indica Intermediate	786	50.30%	49.50%	0.25%	0.00%	NA
Temperate Japonica	767	92.80%	6.90%	0.00%	0.26%	NA
Tropical Japonica	504	90.10%	5.00%	0.99%	3.97%	NA
Japonica Intermediate	241	90.50%	8.70%	0.41%	0.41%	NA
VI/Aromatic	96	84.40%	12.50%	3.12%	0.00%	NA
Intermediate	90	57.80%	41.10%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610115996	C -> A	LOC_Os06g17440.1	upstream_gene_variant ; 4879.0bp to feature; MODIFIER	silent_mutation	Average:84.321; most accessible tissue: Zhenshan97 panicle, score: 93.752	N	N	N	N
vg0610115996	C -> A	LOC_Os06g17430-LOC_Os06g17440	intergenic_region ; MODIFIER	silent_mutation	Average:84.321; most accessible tissue: Zhenshan97 panicle, score: 93.752	N	N	N	N
vg0610115996	C -> DEL	N	N	silent_mutation	Average:84.321; most accessible tissue: Zhenshan97 panicle, score: 93.752	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0610115996	C	A	-0.03	-0.03	-0.04	-0.03	-0.04	-0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610115996	NA	8.26E-06	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610115996	NA	3.22E-07	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610115996	NA	3.56E-06	mr1749	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610115996	NA	8.69E-06	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610115996	NA	1.03E-06	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610115996	NA	9.37E-10	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610115996	NA	4.66E-06	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610115996	NA	4.53E-07	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610115996	NA	3.66E-06	mr1928_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610115996	NA	2.33E-09	mr1931_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610115996	NA	4.68E-08	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251