\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610106990:

Variant ID: vg0610106990 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10106990
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.58, C: 0.42, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAACGAGAGAAGAGAAACGTTGTGGGGAAGAAAAAAAATAAAAGAAAATTTTGGACTGGAATGTTCATGGCATACCACTTTAGTGTCCGTGAGGCATG[T/C]
CATGTAAGCACCACGTAGGATCCTGGAGGGGTCGTGGTAATTTGGGACCAAAATAACACATTTCAATAAGCTCGGGACTAAAAAAATGCATTTTCAAAGT

Reverse complement sequence

ACTTTGAAAATGCATTTTTTTAGTCCCGAGCTTATTGAAATGTGTTATTTTGGTCCCAAATTACCACGACCCCTCCAGGATCCTACGTGGTGCTTACATG[A/G]
CATGCCTCACGGACACTAAAGTGGTATGCCATGAACATTCCAGTCCAAAATTTTCTTTTATTTTTTTTCTTCCCCACAACGTTTCTCTTCTCTCGTTTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 34.60% 0.11% 5.76% NA
All Indica  2759 44.40% 51.70% 0.04% 3.88% NA
All Japonica  1512 82.10% 7.10% 0.20% 10.52% NA
Aus  269 82.50% 17.50% 0.00% 0.00% NA
Indica I  595 70.60% 18.80% 0.00% 10.59% NA
Indica II  465 15.30% 83.00% 0.00% 1.72% NA
Indica III  913 44.80% 54.70% 0.00% 0.55% NA
Indica Intermediate  786 41.30% 54.60% 0.13% 3.94% NA
Temperate Japonica  767 93.00% 5.30% 0.13% 1.56% NA
Tropical Japonica  504 64.90% 9.90% 0.40% 24.80% NA
Japonica Intermediate  241 83.80% 7.10% 0.00% 9.13% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 44.40% 47.80% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610106990 T -> C LOC_Os06g17430.1 upstream_gene_variant ; 1406.0bp to feature; MODIFIER silent_mutation Average:30.165; most accessible tissue: Callus, score: 54.187 N N N N
vg0610106990 T -> C LOC_Os06g17410.1 downstream_gene_variant ; 4251.0bp to feature; MODIFIER silent_mutation Average:30.165; most accessible tissue: Callus, score: 54.187 N N N N
vg0610106990 T -> C LOC_Os06g17410-LOC_Os06g17430 intergenic_region ; MODIFIER silent_mutation Average:30.165; most accessible tissue: Callus, score: 54.187 N N N N
vg0610106990 T -> DEL N N silent_mutation Average:30.165; most accessible tissue: Callus, score: 54.187 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610106990 NA 7.58E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 3.27E-06 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 5.90E-06 NA mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 6.67E-06 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 5.45E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 1.77E-06 NA mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 5.94E-06 NA mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 8.01E-06 NA mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 5.60E-06 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 NA 6.12E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 9.42E-07 NA mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 3.12E-06 NA mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 7.66E-06 NA mr1592_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 NA 1.39E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 NA 2.75E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 NA 1.50E-07 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 NA 8.65E-07 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610106990 NA 5.92E-06 mr1994_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251