Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610105696:

Variant ID: vg0610105696 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10105696
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGCGCTCCCCAAAAACCTGATCGCCCGCCCGTCCGTGTAAACGTCGCAGCAGCGCGTGGTTTCGGAGGCCTACTCTCCCAACACGTGTGCACACACTT[G/A]
TCGGGATGGGATTACCGTAGCAGCAACAGCATTGGAAAATGGATGAAAGTGTGTCTCCCTTCTCTCACGGGAGATCAAATCCATTCTCATTTTATAAGAG

Reverse complement sequence

CTCTTATAAAATGAGAATGGATTTGATCTCCCGTGAGAGAAGGGAGACACACTTTCATCCATTTTCCAATGCTGTTGCTGCTACGGTAATCCCATCCCGA[C/T]
AAGTGTGTGCACACGTGTTGGGAGAGTAGGCCTCCGAAACCACGCGCTGCTGCGACGTTTACACGGACGGGCGGGCGATCAGGTTTTTGGGGAGCGCAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.60%	23.40%	0.36%	1.57%	NA
All Indica	2759	61.90%	34.90%	0.58%	2.57%	NA
All Japonica	1512	93.30%	6.60%	0.00%	0.07%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	84.20%	15.00%	0.17%	0.67%	NA
Indica II	465	17.40%	75.30%	1.51%	5.81%	NA
Indica III	913	73.40%	24.40%	0.44%	1.75%	NA
Indica Intermediate	786	58.10%	38.30%	0.51%	3.05%	NA
Temperate Japonica	767	94.90%	5.00%	0.00%	0.13%	NA
Tropical Japonica	504	90.30%	9.70%	0.00%	0.00%	NA
Japonica Intermediate	241	94.60%	5.40%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	55.60%	41.10%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610105696	G -> A	LOC_Os06g17430.1	upstream_gene_variant ; 2700.0bp to feature; MODIFIER	silent_mutation	Average:40.763; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0610105696	G -> A	LOC_Os06g17410.1	downstream_gene_variant ; 2957.0bp to feature; MODIFIER	silent_mutation	Average:40.763; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0610105696	G -> A	LOC_Os06g17410-LOC_Os06g17430	intergenic_region ; MODIFIER	silent_mutation	Average:40.763; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0610105696	G -> DEL	N	N	silent_mutation	Average:40.763; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610105696	NA	4.94E-08	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	NA	1.28E-08	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	NA	6.29E-07	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	NA	3.49E-08	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	NA	9.48E-07	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	4.28E-07	NA	mr1065_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	1.34E-08	NA	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	1.41E-06	NA	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	1.72E-06	NA	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	1.89E-06	2.20E-10	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	4.52E-07	NA	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	8.18E-08	NA	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	9.98E-10	NA	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	9.79E-07	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	1.00E-06	3.87E-12	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	1.06E-08	NA	mr1091_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	1.29E-08	NA	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	NA	1.25E-09	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	9.39E-07	NA	mr1096_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	NA	1.16E-09	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	4.17E-07	NA	mr1108_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	2.10E-08	NA	mr1108_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	2.69E-06	NA	mr1110_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	4.90E-07	1.04E-10	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	1.18E-06	NA	mr1111_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	4.90E-07	5.75E-07	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	1.42E-07	NA	mr1112_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	5.51E-09	NA	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	6.41E-06	NA	mr1121_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	3.22E-07	1.82E-10	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	1.04E-06	NA	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	1.79E-06	6.20E-08	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	NA	9.18E-08	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	2.14E-07	NA	mr1200_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	9.84E-09	NA	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	NA	2.68E-08	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	9.28E-09	NA	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	8.61E-09	NA	mr1234_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	NA	1.81E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	5.90E-07	NA	mr1526_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	2.62E-09	NA	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	NA	2.96E-06	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	NA	5.59E-08	mr1928_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	NA	4.75E-09	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610105696	NA	1.10E-06	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251