Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610073155:

Variant ID: vg0610073155 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10073155
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

AATGTAATTAACCGGTAGCCTCATTGCTAGGCACCGGGAATCAGCGGACTGCACGCAATCTCCAGTTAGCATACCTTTCTATTAAGCATTCCCCACGAAG[G/A]
CAAAAGGCAAACTCCTGTGGAAGCCTATCTTGTATTTTGTAAACATTCATGTTAATGAATCATGATTAATAAAATACAGTATTTCCCTATTTTCTGTGTG

Reverse complement sequence

CACACAGAAAATAGGGAAATACTGTATTTTATTAATCATGATTCATTAACATGAATGTTTACAAAATACAAGATAGGCTTCCACAGGAGTTTGCCTTTTG[C/T]
CTTCGTGGGGAATGCTTAATAGAAAGGTATGCTAACTGGAGATTGCGTGCAGTCCGCTGATTCCCGGTGCCTAGCAATGAGGCTACCGGTTAATTACATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	5.00%	4.40%	24.12%	NA
All Indica	2759	53.50%	8.00%	5.94%	32.51%	NA
All Japonica	1512	82.90%	0.70%	2.25%	14.22%	NA
Aus	269	98.50%	0.00%	0.74%	0.74%	NA
Indica I	595	80.50%	2.40%	6.89%	10.25%	NA
Indica II	465	73.50%	8.60%	4.52%	13.33%	NA
Indica III	913	26.70%	14.50%	5.70%	53.12%	NA
Indica Intermediate	786	52.30%	4.60%	6.36%	36.77%	NA
Temperate Japonica	767	93.50%	1.20%	1.04%	4.30%	NA
Tropical Japonica	504	65.10%	0.20%	4.17%	30.56%	NA
Japonica Intermediate	241	86.30%	0.00%	2.07%	11.62%	NA
VI/Aromatic	96	94.80%	1.00%	0.00%	4.17%	NA
Intermediate	90	64.40%	2.20%	8.89%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610073155	G -> A	LOC_Os06g17370.1	upstream_gene_variant ; 3201.0bp to feature; MODIFIER	silent_mutation	Average:40.727; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg0610073155	G -> A	LOC_Os06g17380.1	intron_variant ; MODIFIER	silent_mutation	Average:40.727; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg0610073155	G -> DEL	N	N	silent_mutation	Average:40.727; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610073155	NA	9.96E-09	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	1.79E-08	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	9.18E-11	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	1.98E-07	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	1.00E-06	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	1.29E-08	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	1.80E-08	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	3.01E-08	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	4.44E-10	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	6.80E-07	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	5.87E-07	mr1571	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	1.28E-10	8.93E-18	mr1695	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	4.35E-11	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	1.22E-07	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	2.12E-09	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	7.55E-07	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	1.06E-06	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	2.79E-08	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	8.82E-06	6.71E-09	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	3.01E-08	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	1.86E-06	1.43E-09	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	7.70E-09	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	5.25E-09	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	1.25E-07	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	2.07E-06	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	5.16E-06	5.84E-10	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	NA	8.45E-06	mr1571_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155	1.86E-14	1.47E-21	mr1695_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251