\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610073155:

Variant ID: vg0610073155 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10073155
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


AATGTAATTAACCGGTAGCCTCATTGCTAGGCACCGGGAATCAGCGGACTGCACGCAATCTCCAGTTAGCATACCTTTCTATTAAGCATTCCCCACGAAG[G/A]
CAAAAGGCAAACTCCTGTGGAAGCCTATCTTGTATTTTGTAAACATTCATGTTAATGAATCATGATTAATAAAATACAGTATTTCCCTATTTTCTGTGTG

Reverse complement sequence

CACACAGAAAATAGGGAAATACTGTATTTTATTAATCATGATTCATTAACATGAATGTTTACAAAATACAAGATAGGCTTCCACAGGAGTTTGCCTTTTG[C/T]
CTTCGTGGGGAATGCTTAATAGAAAGGTATGCTAACTGGAGATTGCGTGCAGTCCGCTGATTCCCGGTGCCTAGCAATGAGGCTACCGGTTAATTACATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 5.00% 4.40% 24.12% NA
All Indica  2759 53.50% 8.00% 5.94% 32.51% NA
All Japonica  1512 82.90% 0.70% 2.25% 14.22% NA
Aus  269 98.50% 0.00% 0.74% 0.74% NA
Indica I  595 80.50% 2.40% 6.89% 10.25% NA
Indica II  465 73.50% 8.60% 4.52% 13.33% NA
Indica III  913 26.70% 14.50% 5.70% 53.12% NA
Indica Intermediate  786 52.30% 4.60% 6.36% 36.77% NA
Temperate Japonica  767 93.50% 1.20% 1.04% 4.30% NA
Tropical Japonica  504 65.10% 0.20% 4.17% 30.56% NA
Japonica Intermediate  241 86.30% 0.00% 2.07% 11.62% NA
VI/Aromatic  96 94.80% 1.00% 0.00% 4.17% NA
Intermediate  90 64.40% 2.20% 8.89% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610073155 G -> A LOC_Os06g17370.1 upstream_gene_variant ; 3201.0bp to feature; MODIFIER silent_mutation Average:40.727; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0610073155 G -> A LOC_Os06g17380.1 intron_variant ; MODIFIER silent_mutation Average:40.727; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0610073155 G -> DEL N N silent_mutation Average:40.727; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610073155 NA 9.96E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 1.79E-08 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 9.18E-11 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 1.98E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 1.00E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 1.29E-08 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 1.80E-08 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 3.01E-08 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 4.44E-10 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 6.80E-07 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 5.87E-07 mr1571 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 1.28E-10 8.93E-18 mr1695 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 4.35E-11 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 1.22E-07 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 2.12E-09 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 7.55E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 1.06E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 2.79E-08 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 8.82E-06 6.71E-09 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 3.01E-08 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 1.86E-06 1.43E-09 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 7.70E-09 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 5.25E-09 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 1.25E-07 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 2.07E-06 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 5.16E-06 5.84E-10 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 NA 8.45E-06 mr1571_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610073155 1.86E-14 1.47E-21 mr1695_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251