RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0610056324:

Variant ID: vg0610056324 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10056324
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 359. )

Flanking Sequence (100 bp) in Reference Genome:

GATGTATGATAGGATGATGATCCTTGTCAACAAGATCAAAGGACTTGGGAGTGAGGACATGACAAATCACTTTGTGGTCAAGAGACTTCTCCGTGCTTTT[G/T]
GTCCAAGAAATCCCACTCTTGTATCAATTATACGGGAAAGGAAAGACTTCAAGAGGCTCACCCCAAGTGACATTCTTAGAAGAATTGTGTCTCATGAGAT

Reverse complement sequence

ATCTCATGAGACACAATTCTTCTAAGAATGTCACTTGGGGTGAGCCTCTTGAAGTCTTTCCTTTCCCGTATAATTGATACAAGAGTGGGATTTCTTGGAC[C/A]
AAAAGCACGGAGAAGTCTCTTGACCACAAAGTGATTTGTCATGTCCTCACTCCCAAGTCCTTTGATCTTGTTGACAAGGATCATCATCCTATCATACATC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.30%	14.90%	7.07%	4.74%	NA
All Indica	2759	55.90%	24.30%	11.74%	8.05%	NA
All Japonica	1512	98.70%	0.90%	0.26%	0.13%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	26.40%	39.20%	22.86%	11.60%	NA
Indica II	465	29.00%	40.90%	16.77%	13.33%	NA
Indica III	913	84.20%	9.30%	2.63%	3.83%	NA
Indica Intermediate	786	61.30%	20.60%	10.94%	7.12%	NA
Temperate Japonica	767	99.20%	0.40%	0.13%	0.26%	NA
Tropical Japonica	504	99.20%	0.60%	0.20%	0.00%	NA
Japonica Intermediate	241	95.90%	3.30%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	74.40%	18.90%	6.67%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610056324	G -> T	LOC_Os06g17350.1	missense_variant ; p.Gly115Cys; MODERATE	nonsynonymous_codon ; G115C	Average:35.563; most accessible tissue: Minghui63 panicle, score: 53.77	probably damaging	3.045	DELETERIOUS	0.03
vg0610056324	G -> DEL	LOC_Os06g17350.1	N	frameshift_variant	Average:35.563; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610056324	4.51E-07	4.43E-59	mr1065	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610056324	6.78E-06	6.17E-19	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610056324	5.94E-06	4.16E-53	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610056324	NA	1.29E-17	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610056324	6.96E-07	NA	mr1087	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610056324	1.86E-06	1.09E-14	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610056324	4.05E-11	7.43E-63	mr1091	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610056324	6.27E-09	1.32E-25	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610056324	NA	2.71E-07	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610056324	NA	7.86E-08	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 83 entries

Previous1 2 3 4 5…9Next

Search for Variation information by Variation ID:

Detailed information for vg0610056324:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact