\
| Variant ID: vg0609990520 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9990520 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 286. )
AGTTGGTGCTGTTTTTGCCTGTAGTTGGTGGCACTGAGCATGACTCTTTCTTTTTAGATCAGATATGGTGTTTTCTGCATGATCCAGAACATTGTCAACT[T/C]
GTCATTGTGGCTAATCTTCAACTGTTAGATCTGTCTGTAGGACTATACATACACATCATTTGTTTGGCAATAGCTAACAGAATGAGCTCTGGCAAGAGAT
ATCTCTTGCCAGAGCTCATTCTGTTAGCTATTGCCAAACAAATGATGTGTATGTATAGTCCTACAGACAGATCTAACAGTTGAAGATTAGCCACAATGAC[A/G]
AGTTGACAATGTTCTGGATCATGCAGAAAACACCATATCTGATCTAAAAAGAAAGAGTCATGCTCAGTGCCACCAACTACAGGCAAAAACAGCACCAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.40% | 33.60% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 21.80% | 78.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.10% | 3.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 15.00% | 85.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 32.50% | 67.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 20.70% | 79.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609990520 | T -> C | LOC_Os06g17240.1 | downstream_gene_variant ; 1583.0bp to feature; MODIFIER | silent_mutation | Average:65.498; most accessible tissue: Callus, score: 89.683 | N | N | N | N |
| vg0609990520 | T -> C | LOC_Os06g17250.1 | downstream_gene_variant ; 1313.0bp to feature; MODIFIER | silent_mutation | Average:65.498; most accessible tissue: Callus, score: 89.683 | N | N | N | N |
| vg0609990520 | T -> C | LOC_Os06g17240-LOC_Os06g17250 | intergenic_region ; MODIFIER | silent_mutation | Average:65.498; most accessible tissue: Callus, score: 89.683 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609990520 | NA | 5.83E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 1.09E-52 | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | 1.35E-06 | 1.35E-06 | mr1068 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 1.03E-49 | mr1078 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 2.06E-55 | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 1.33E-06 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 1.50E-36 | mr1094 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 1.72E-06 | mr1094 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 6.42E-50 | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | 8.74E-06 | 2.72E-08 | mr1111 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 2.34E-50 | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | 5.16E-06 | 2.59E-08 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 1.53E-43 | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | 4.90E-07 | 4.90E-07 | mr1144 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 1.48E-16 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 2.18E-10 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 4.09E-49 | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 2.73E-06 | mr1211 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 8.96E-07 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 5.12E-44 | mr1526 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | 2.04E-07 | 2.04E-07 | mr1526 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 4.46E-31 | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 7.69E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 5.46E-14 | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | 7.43E-06 | 7.43E-06 | mr1670 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 4.68E-07 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 4.98E-08 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 6.02E-09 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 1.18E-08 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 4.96E-32 | mr1878 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 1.77E-63 | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 1.59E-62 | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 4.54E-08 | mr1090_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 8.51E-60 | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 1.16E-51 | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 1.82E-53 | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 6.80E-55 | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 7.79E-07 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 1.45E-34 | mr1221_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 4.75E-22 | mr1531_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 1.96E-32 | mr1571_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609990520 | NA | 3.77E-09 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |