\
| Variant ID: vg0609926305 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9926305 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGTGTTAGGAGGAATCAGATCTACAGCGTGTTTTTTTTTCTTTTGCTTTTTCGCTACTTTGGGAATCGGAAATTTTTTTCGCTGTTTTTTTTATTTTGAC[G/A]
GACGATGGAAGCACTTTTTATTTTTATAATAGTAGAGAATAGTTGAAAGTGAATAGGGGAATTAAAATTTCCAGCTGATCATCTCCCCACCAGTTACTTA
TAAGTAACTGGTGGGGAGATGATCAGCTGGAAATTTTAATTCCCCTATTCACTTTCAACTATTCTCTACTATTATAAAAATAAAAAGTGCTTCCATCGTC[C/T]
GTCAAAATAAAAAAAACAGCGAAAAAAATTTCCGATTCCCAAAGTAGCGAAAAAGCAAAAGAAAAAAAAACACGCTGTAGATCTGATTCCTCCTAACACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.00% | 3.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 95.80% | 4.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609926305 | G -> A | LOC_Os06g17120.1 | downstream_gene_variant ; 3716.0bp to feature; MODIFIER | silent_mutation | Average:35.17; most accessible tissue: Callus, score: 53.205 | N | N | N | N |
| vg0609926305 | G -> A | LOC_Os06g17120-LOC_Os06g17130 | intergenic_region ; MODIFIER | silent_mutation | Average:35.17; most accessible tissue: Callus, score: 53.205 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609926305 | NA | 2.07E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926305 | NA | 1.43E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926305 | NA | 2.48E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926305 | NA | 7.26E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926305 | 3.49E-09 | 2.74E-11 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926305 | 7.17E-08 | 1.73E-09 | mr1409_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926305 | 4.11E-07 | 3.76E-08 | mr1559_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926305 | 1.77E-09 | 6.47E-13 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926305 | 1.83E-07 | 2.96E-08 | mr1703_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926305 | NA | 2.38E-07 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |