\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609926305:

Variant ID: vg0609926305 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9926305
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTGTTAGGAGGAATCAGATCTACAGCGTGTTTTTTTTTCTTTTGCTTTTTCGCTACTTTGGGAATCGGAAATTTTTTTCGCTGTTTTTTTTATTTTGAC[G/A]
GACGATGGAAGCACTTTTTATTTTTATAATAGTAGAGAATAGTTGAAAGTGAATAGGGGAATTAAAATTTCCAGCTGATCATCTCCCCACCAGTTACTTA

Reverse complement sequence

TAAGTAACTGGTGGGGAGATGATCAGCTGGAAATTTTAATTCCCCTATTCACTTTCAACTATTCTCTACTATTATAAAAATAAAAAGTGCTTCCATCGTC[C/T]
GTCAAAATAAAAAAAACAGCGAAAAAAATTTCCGATTCCCAAAGTAGCGAAAAAGCAAAAGAAAAAAAAACACGCTGTAGATCTGATTCCTCCTAACACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.00% 3.00% 0.02% 0.00% NA
All Indica  2759 97.20% 2.80% 0.00% 0.00% NA
All Japonica  1512 95.80% 4.20% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 91.80% 8.20% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 92.40% 7.60% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609926305 G -> A LOC_Os06g17120.1 downstream_gene_variant ; 3716.0bp to feature; MODIFIER silent_mutation Average:35.17; most accessible tissue: Callus, score: 53.205 N N N N
vg0609926305 G -> A LOC_Os06g17120-LOC_Os06g17130 intergenic_region ; MODIFIER silent_mutation Average:35.17; most accessible tissue: Callus, score: 53.205 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609926305 NA 2.07E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609926305 NA 1.43E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609926305 NA 2.48E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609926305 NA 7.26E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609926305 3.49E-09 2.74E-11 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609926305 7.17E-08 1.73E-09 mr1409_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609926305 4.11E-07 3.76E-08 mr1559_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609926305 1.77E-09 6.47E-13 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609926305 1.83E-07 2.96E-08 mr1703_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609926305 NA 2.38E-07 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251