Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609896125:

Variant ID: vg0609896125 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 9896125
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TGAAGAAATGACCAAAATAAAAGTTGTAGATATTGATGAGTTATACAGCTTTGATGTTGATGACTTATTCAGTTGAAATAATTTAGTATTTGAAAATGTT[G/A]
TTTGCAGTTGACATAATTTGAAATTCAAATTCAAATTATTGAAACAGAGTCATATAGCAAAATGACTAAAACAAAAGTTGTAGATATTGATGACTTATAC

Reverse complement sequence

GTATAAGTCATCAATATCTACAACTTTTGTTTTAGTCATTTTGCTATATGACTCTGTTTCAATAATTTGAATTTGAATTTCAAATTATGTCAACTGCAAA[C/T]
AACATTTTCAAATACTAAATTATTTCAACTGAATAAGTCATCAACATCAAAGCTGTATAACTCATCAATATCTACAACTTTTATTTTGGTCATTTCTTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.40%	11.30%	0.19%	0.06%	NA
All Indica	2759	81.30%	18.20%	0.33%	0.11%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	97.50%	2.50%	0.00%	0.00%	NA
Indica II	465	77.60%	21.50%	0.65%	0.22%	NA
Indica III	913	71.30%	28.10%	0.33%	0.22%	NA
Indica Intermediate	786	83.00%	16.70%	0.38%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609896125	G -> A	LOC_Os06g17060.1	upstream_gene_variant ; 4128.0bp to feature; MODIFIER	silent_mutation	Average:33.336; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0609896125	G -> A	LOC_Os06g17070.1	upstream_gene_variant ; 957.0bp to feature; MODIFIER	silent_mutation	Average:33.336; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0609896125	G -> A	LOC_Os06g17070-LOC_Os06g17080	intergenic_region ; MODIFIER	silent_mutation	Average:33.336; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0609896125	G -> DEL	N	N	silent_mutation	Average:33.336; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0609896125	5.44E-10	NA	mr1695	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609896125	4.23E-11	NA	mr1695	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609896125	1.40E-06	NA	mr1695_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251