\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609896125:

Variant ID: vg0609896125 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9896125
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAGAAATGACCAAAATAAAAGTTGTAGATATTGATGAGTTATACAGCTTTGATGTTGATGACTTATTCAGTTGAAATAATTTAGTATTTGAAAATGTT[G/A]
TTTGCAGTTGACATAATTTGAAATTCAAATTCAAATTATTGAAACAGAGTCATATAGCAAAATGACTAAAACAAAAGTTGTAGATATTGATGACTTATAC

Reverse complement sequence

GTATAAGTCATCAATATCTACAACTTTTGTTTTAGTCATTTTGCTATATGACTCTGTTTCAATAATTTGAATTTGAATTTCAAATTATGTCAACTGCAAA[C/T]
AACATTTTCAAATACTAAATTATTTCAACTGAATAAGTCATCAACATCAAAGCTGTATAACTCATCAATATCTACAACTTTTATTTTGGTCATTTCTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.40% 11.30% 0.19% 0.06% NA
All Indica  2759 81.30% 18.20% 0.33% 0.11% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 97.50% 2.50% 0.00% 0.00% NA
Indica II  465 77.60% 21.50% 0.65% 0.22% NA
Indica III  913 71.30% 28.10% 0.33% 0.22% NA
Indica Intermediate  786 83.00% 16.70% 0.38% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609896125 G -> A LOC_Os06g17060.1 upstream_gene_variant ; 4128.0bp to feature; MODIFIER silent_mutation Average:33.336; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0609896125 G -> A LOC_Os06g17070.1 upstream_gene_variant ; 957.0bp to feature; MODIFIER silent_mutation Average:33.336; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0609896125 G -> A LOC_Os06g17070-LOC_Os06g17080 intergenic_region ; MODIFIER silent_mutation Average:33.336; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0609896125 G -> DEL N N silent_mutation Average:33.336; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609896125 5.44E-10 NA mr1695 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609896125 4.23E-11 NA mr1695 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609896125 1.40E-06 NA mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251