| Variant ID: vg0609896125 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9896125 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 107. )
TGAAGAAATGACCAAAATAAAAGTTGTAGATATTGATGAGTTATACAGCTTTGATGTTGATGACTTATTCAGTTGAAATAATTTAGTATTTGAAAATGTT[G/A]
TTTGCAGTTGACATAATTTGAAATTCAAATTCAAATTATTGAAACAGAGTCATATAGCAAAATGACTAAAACAAAAGTTGTAGATATTGATGACTTATAC
GTATAAGTCATCAATATCTACAACTTTTGTTTTAGTCATTTTGCTATATGACTCTGTTTCAATAATTTGAATTTGAATTTCAAATTATGTCAACTGCAAA[C/T]
AACATTTTCAAATACTAAATTATTTCAACTGAATAAGTCATCAACATCAAAGCTGTATAACTCATCAATATCTACAACTTTTATTTTGGTCATTTCTTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.40% | 11.30% | 0.19% | 0.06% | NA |
| All Indica | 2759 | 81.30% | 18.20% | 0.33% | 0.11% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 77.60% | 21.50% | 0.65% | 0.22% | NA |
| Indica III | 913 | 71.30% | 28.10% | 0.33% | 0.22% | NA |
| Indica Intermediate | 786 | 83.00% | 16.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609896125 | G -> A | LOC_Os06g17060.1 | upstream_gene_variant ; 4128.0bp to feature; MODIFIER | silent_mutation | Average:33.336; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0609896125 | G -> A | LOC_Os06g17070.1 | upstream_gene_variant ; 957.0bp to feature; MODIFIER | silent_mutation | Average:33.336; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0609896125 | G -> A | LOC_Os06g17070-LOC_Os06g17080 | intergenic_region ; MODIFIER | silent_mutation | Average:33.336; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0609896125 | G -> DEL | N | N | silent_mutation | Average:33.336; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609896125 | 5.44E-10 | NA | mr1695 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609896125 | 4.23E-11 | NA | mr1695 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609896125 | 1.40E-06 | NA | mr1695_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |