\
| Variant ID: vg0609889578 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9889578 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATAAGCATCATGAACATACCAAGAATGCAATAGAATTGCGACTAACAGGACAAACAGAGGTATCAAAGAATGAGTTAACAGTAGGAGAAAGACATACCC[C/T]
GAGAATGTCCCTCCACTGGATTGTGAGGCAGAATTGCCTCCGTTGACGTTGACGTTCGCAGCGGCTCCGGCTCCCGGCGCGCCATCTTCAGGGATGGCGG
CCGCCATCCCTGAAGATGGCGCGCCGGGAGCCGGAGCCGCTGCGAACGTCAACGTCAACGGAGGCAATTCTGCCTCACAATCCAGTGGAGGGACATTCTC[G/A]
GGGTATGTCTTTCTCCTACTGTTAACTCATTCTTTGATACCTCTGTTTGTCCTGTTAGTCGCAATTCTATTGCATTCTTGGTATGTTCATGATGCTTATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.10% | 8.10% | 0.61% | 3.13% | NA |
| All Indica | 2759 | 89.10% | 4.90% | 0.94% | 5.15% | NA |
| All Japonica | 1512 | 84.10% | 15.50% | 0.13% | 0.26% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.60% | 10.10% | 0.84% | 1.51% | NA |
| Indica II | 465 | 91.20% | 1.50% | 1.29% | 6.02% | NA |
| Indica III | 913 | 87.40% | 2.10% | 1.31% | 9.20% | NA |
| Indica Intermediate | 786 | 90.80% | 6.10% | 0.38% | 2.67% | NA |
| Temperate Japonica | 767 | 94.10% | 5.60% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 68.10% | 31.20% | 0.40% | 0.40% | NA |
| Japonica Intermediate | 241 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 78.90% | 18.90% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609889578 | C -> T | LOC_Os06g17050.1 | splice_region_variant&synonymous_variant ; p.Ser47Ser; LOW | synonymous_codon | Average:39.251; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg0609889578 | C -> DEL | LOC_Os06g17050.1 | N | frameshift_variant | Average:39.251; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609889578 | NA | 3.57E-06 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609889578 | NA | 3.78E-07 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609889578 | NA | 3.56E-07 | mr1094 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609889578 | NA | 1.10E-06 | mr1111 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609889578 | NA | 1.15E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609889578 | 2.52E-06 | NA | mr1695 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609889578 | 1.21E-13 | 1.46E-17 | mr1695 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609889578 | 3.31E-08 | NA | mr1695_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609889578 | 1.71E-15 | 4.94E-14 | mr1695_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |