\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609889408:

Variant ID: vg0609889408 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9889408
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CCATCGGCATGGCAAGCAGTATGCCAGCAGCCAGTAGGTTCTCATTGTTGGAAATATAGTCATATATCGGCATATTTTAATCTAAAATATTAAGACAATA[A/T]
TCATGGTATGAACAATGTGGGGTGATCTAGTGATAAAATGTAACATAACCAGGAGCATGCTTAAAGTATAATAAGCATCATGAACATACCAAGAATGCAA

Reverse complement sequence

TTGCATTCTTGGTATGTTCATGATGCTTATTATACTTTAAGCATGCTCCTGGTTATGTTACATTTTATCACTAGATCACCCCACATTGTTCATACCATGA[T/A]
TATTGTCTTAATATTTTAGATTAAAATATGCCGATATATGACTATATTTCCAACAATGAGAACCTACTGGCTGCTGGCATACTGCTTGCCATGCCGATGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 11.80% 0.00% 0.00% NA
All Indica  2759 81.00% 19.00% 0.00% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 97.50% 2.50% 0.00% 0.00% NA
Indica II  465 76.80% 23.20% 0.00% 0.00% NA
Indica III  913 70.80% 29.20% 0.00% 0.00% NA
Indica Intermediate  786 83.00% 17.00% 0.00% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609889408 A -> T LOC_Os06g17040.1 upstream_gene_variant ; 3081.0bp to feature; MODIFIER silent_mutation Average:47.778; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg0609889408 A -> T LOC_Os06g17060.1 downstream_gene_variant ; 1224.0bp to feature; MODIFIER silent_mutation Average:47.778; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg0609889408 A -> T LOC_Os06g17070.1 downstream_gene_variant ; 2965.0bp to feature; MODIFIER silent_mutation Average:47.778; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg0609889408 A -> T LOC_Os06g17050.1 intron_variant ; MODIFIER silent_mutation Average:47.778; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609889408 NA 4.05E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609889408 8.93E-09 NA mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609889408 3.95E-09 NA mr1695 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609889408 1.74E-07 NA mr1695_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609889408 2.24E-09 5.58E-06 mr1695_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251