\
| Variant ID: vg0609889408 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9889408 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 227. )
CCATCGGCATGGCAAGCAGTATGCCAGCAGCCAGTAGGTTCTCATTGTTGGAAATATAGTCATATATCGGCATATTTTAATCTAAAATATTAAGACAATA[A/T]
TCATGGTATGAACAATGTGGGGTGATCTAGTGATAAAATGTAACATAACCAGGAGCATGCTTAAAGTATAATAAGCATCATGAACATACCAAGAATGCAA
TTGCATTCTTGGTATGTTCATGATGCTTATTATACTTTAAGCATGCTCCTGGTTATGTTACATTTTATCACTAGATCACCCCACATTGTTCATACCATGA[T/A]
TATTGTCTTAATATTTTAGATTAAAATATGCCGATATATGACTATATTTCCAACAATGAGAACCTACTGGCTGCTGGCATACTGCTTGCCATGCCGATGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 70.80% | 29.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.00% | 17.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609889408 | A -> T | LOC_Os06g17040.1 | upstream_gene_variant ; 3081.0bp to feature; MODIFIER | silent_mutation | Average:47.778; most accessible tissue: Minghui63 young leaf, score: 65.161 | N | N | N | N |
| vg0609889408 | A -> T | LOC_Os06g17060.1 | downstream_gene_variant ; 1224.0bp to feature; MODIFIER | silent_mutation | Average:47.778; most accessible tissue: Minghui63 young leaf, score: 65.161 | N | N | N | N |
| vg0609889408 | A -> T | LOC_Os06g17070.1 | downstream_gene_variant ; 2965.0bp to feature; MODIFIER | silent_mutation | Average:47.778; most accessible tissue: Minghui63 young leaf, score: 65.161 | N | N | N | N |
| vg0609889408 | A -> T | LOC_Os06g17050.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.778; most accessible tissue: Minghui63 young leaf, score: 65.161 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609889408 | NA | 4.05E-06 | mr1122 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609889408 | 8.93E-09 | NA | mr1695 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609889408 | 3.95E-09 | NA | mr1695 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609889408 | 1.74E-07 | NA | mr1695_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609889408 | 2.24E-09 | 5.58E-06 | mr1695_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |