\
| Variant ID: vg0609867319 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9867319 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.51, A: 0.49, others allele: 0.00, population size: 86. )
GCCTCTTAAGAGAGCCGAAGTGGGCCTCTTAATTGCCTGCCTGTCGGTGCACACACTACATGGCCCATGTGATGGGAGGGATGGGAGGGACGGATCTGCA[A/G]
CCTCCGGTCATAGGAGTGGTGACTTCGAGCGTGGCGGCCTCCAAGGCGTGGATCTGCCGCCACCAAGCACGGGAGTGACAACAACGAGTGCGGTAGCCTG
CAGGCTACCGCACTCGTTGTTGTCACTCCCGTGCTTGGTGGCGGCAGATCCACGCCTTGGAGGCCGCCACGCTCGAAGTCACCACTCCTATGACCGGAGG[T/C]
TGCAGATCCGTCCCTCCCATCCCTCCCATCACATGGGCCATGTAGTGTGTGCACCGACAGGCAGGCAATTAAGAGGCCCACTTCGGCTCTCTTAAGAGGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.30% | 48.40% | 0.19% | 0.11% | NA |
| All Indica | 2759 | 58.60% | 41.10% | 0.14% | 0.18% | NA |
| All Japonica | 1512 | 50.10% | 49.70% | 0.26% | 0.00% | NA |
| Aus | 269 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.60% | 7.10% | 0.17% | 0.17% | NA |
| Indica II | 465 | 72.70% | 26.70% | 0.22% | 0.43% | NA |
| Indica III | 913 | 32.20% | 67.60% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 55.20% | 44.50% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 69.50% | 30.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 33.70% | 66.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 22.40% | 76.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 44.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609867319 | A -> G | LOC_Os06g17000.1 | upstream_gene_variant ; 3381.0bp to feature; MODIFIER | silent_mutation | Average:75.711; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0609867319 | A -> G | LOC_Os06g17020.1 | downstream_gene_variant ; 3343.0bp to feature; MODIFIER | silent_mutation | Average:75.711; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0609867319 | A -> G | LOC_Os06g17000-LOC_Os06g17020 | intergenic_region ; MODIFIER | silent_mutation | Average:75.711; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0609867319 | A -> DEL | N | N | silent_mutation | Average:75.711; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609867319 | 9.16E-06 | 2.27E-13 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 1.86E-13 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 1.64E-06 | NA | mr1087 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 2.56E-07 | 2.40E-12 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 2.23E-07 | 3.73E-15 | mr1091 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 3.50E-07 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 8.06E-12 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 3.67E-09 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 1.04E-10 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 2.59E-06 | 1.18E-09 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 6.70E-11 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 6.14E-06 | 1.58E-13 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 5.92E-06 | 1.58E-09 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 7.67E-08 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 5.67E-06 | mr1535 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 1.65E-09 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 6.74E-06 | NA | mr1695 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 4.68E-06 | NA | mr1695 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 3.82E-06 | 1.24E-07 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 9.93E-08 | 9.27E-19 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 3.38E-06 | 2.28E-15 | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 7.41E-06 | 6.60E-09 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 1.90E-09 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 6.01E-07 | 3.82E-13 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 1.08E-07 | 2.31E-16 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 3.95E-07 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 1.65E-14 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 1.72E-07 | 6.19E-12 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 2.94E-07 | 2.11E-15 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 5.12E-06 | 9.43E-08 | mr1197_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 7.90E-06 | 4.52E-13 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 6.11E-06 | 3.38E-13 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 1.94E-06 | 4.24E-16 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 1.00E-07 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 3.23E-06 | mr1341_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 1.39E-07 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 9.51E-11 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 5.62E-06 | 5.63E-06 | mr1571_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 3.05E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 2.31E-09 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | 1.62E-06 | NA | mr1695_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 1.60E-09 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609867319 | NA | 8.17E-09 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |