\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609862613:

Variant ID: vg0609862613 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9862613
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TGATCCCCTCTGGGGGGACATCGGGGGAGAAGGCACGGAGGTCACGTGTTCCGAGCACAGACATAGCGAACTCAACCACCGACTCGATAGACGTGGCACA[C/T]
GCACGTTCTTCTCCCTTGATCGGGCGGTGGTGCTCACAAGTGTCCAACGCCGATTGTATACCGTCGGCCATGACGAGGGATATAGGCGAAAACATTGCCA

Reverse complement sequence

TGGCAATGTTTTCGCCTATATCCCTCGTCATGGCCGACGGTATACAATCGGCGTTGGACACTTGTGAGCACCACCGCCCGATCAAGGGAGAAGAACGTGC[G/A]
TGTGCCACGTCTATCGAGTCGGTGGTTGAGTTCGCTATGTCTGTGCTCGGAACACGTGACCTCCGTGCCTTCTCCCCCGATGTCCCCCCAGAGGGGATCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 12.40% 0.06% 0.00% NA
All Indica  2759 88.10% 11.80% 0.11% 0.00% NA
All Japonica  1512 84.10% 15.90% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 84.70% 15.10% 0.17% 0.00% NA
Indica II  465 90.80% 9.20% 0.00% 0.00% NA
Indica III  913 86.90% 13.00% 0.11% 0.00% NA
Indica Intermediate  786 90.60% 9.30% 0.13% 0.00% NA
Temperate Japonica  767 94.30% 5.70% 0.00% 0.00% NA
Tropical Japonica  504 67.90% 32.10% 0.00% 0.00% NA
Japonica Intermediate  241 85.50% 14.50% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609862613 C -> T LOC_Os06g17000.1 synonymous_variant ; p.Ala190Ala; LOW synonymous_codon Average:75.514; most accessible tissue: Zhenshan97 panicle, score: 95.081 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0609862613 C T -0.02 -0.01 -0.01 -0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609862613 NA 2.08E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609862613 NA 4.46E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609862613 NA 8.25E-06 mr1111 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609862613 NA 1.40E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609862613 NA 8.68E-06 mr1625 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609862613 3.69E-11 8.92E-15 mr1695 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609862613 5.35E-07 2.07E-09 mr1221_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609862613 4.89E-06 NA mr1695_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609862613 1.55E-11 1.13E-10 mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251