\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609857445:

Variant ID: vg0609857445 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 9857445
Reference Allele: AAlternative Allele: G,ACG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AGATAGAGATAGGGATTTAAGTGGGCAGACCCGTAAACTTAATTATAGTACAAATAATTAGGTTACTCGATAGGCTATCCGCTTGTTTGTACTATTATAT[A/G,ACG]
TAGGTTTACGGGTTATCCGTTTGCACCCTTAGATAGACTTGTTTAACTTTCGAGCCAAGCCTGACATTTTTGTCCACCTATCTATTGTAGGACAACCCCT

Reverse complement sequence

AGGGGTTGTCCTACAATAGATAGGTGGACAAAAATGTCAGGCTTGGCTCGAAAGTTAAACAAGTCTATCTAAGGGTGCAAACGGATAACCCGTAAACCTA[T/C,CGT]
ATATAATAGTACAAACAAGCGGATAGCCTATCGAGTAACCTAATTATTTGTACTATAATTAAGTTTACGGGTCTGCCCACTTAAATCCCTATCTCTATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.50% 29.90% 0.57% 0.00% ACG: 0.02%
All Indica  2759 71.90% 27.30% 0.80% 0.00% NA
All Japonica  1512 58.10% 41.70% 0.13% 0.00% ACG: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 79.80% 20.00% 0.17% 0.00% NA
Indica II  465 89.20% 10.80% 0.00% 0.00% NA
Indica III  913 60.00% 37.90% 2.08% 0.00% NA
Indica Intermediate  786 69.30% 30.40% 0.25% 0.00% NA
Temperate Japonica  767 46.70% 53.30% 0.00% 0.00% NA
Tropical Japonica  504 66.10% 33.50% 0.20% 0.00% ACG: 0.20%
Japonica Intermediate  241 77.60% 22.00% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 67.80% 28.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609857445 A -> G LOC_Os06g16980.1 upstream_gene_variant ; 465.0bp to feature; MODIFIER silent_mutation Average:95.205; most accessible tissue: Callus, score: 99.497 N N N N
vg0609857445 A -> G LOC_Os06g16980.2 upstream_gene_variant ; 465.0bp to feature; MODIFIER silent_mutation Average:95.205; most accessible tissue: Callus, score: 99.497 N N N N
vg0609857445 A -> G LOC_Os06g16990.1 downstream_gene_variant ; 78.0bp to feature; MODIFIER silent_mutation Average:95.205; most accessible tissue: Callus, score: 99.497 N N N N
vg0609857445 A -> G LOC_Os06g17000.1 downstream_gene_variant ; 4431.0bp to feature; MODIFIER silent_mutation Average:95.205; most accessible tissue: Callus, score: 99.497 N N N N
vg0609857445 A -> G LOC_Os06g16980-LOC_Os06g16990 intergenic_region ; MODIFIER silent_mutation Average:95.205; most accessible tissue: Callus, score: 99.497 N N N N
vg0609857445 A -> ACG LOC_Os06g16980.1 upstream_gene_variant ; 466.0bp to feature; MODIFIER silent_mutation Average:95.205; most accessible tissue: Callus, score: 99.497 N N N N
vg0609857445 A -> ACG LOC_Os06g16980.2 upstream_gene_variant ; 466.0bp to feature; MODIFIER silent_mutation Average:95.205; most accessible tissue: Callus, score: 99.497 N N N N
vg0609857445 A -> ACG LOC_Os06g16990.1 downstream_gene_variant ; 77.0bp to feature; MODIFIER silent_mutation Average:95.205; most accessible tissue: Callus, score: 99.497 N N N N
vg0609857445 A -> ACG LOC_Os06g17000.1 downstream_gene_variant ; 4430.0bp to feature; MODIFIER silent_mutation Average:95.205; most accessible tissue: Callus, score: 99.497 N N N N
vg0609857445 A -> ACG LOC_Os06g16980-LOC_Os06g16990 intergenic_region ; MODIFIER silent_mutation Average:95.205; most accessible tissue: Callus, score: 99.497 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0609857445 A ACG 0.15 0.17 0.1 0.11 0.09 0.1
vg0609857445 A G 0.01 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609857445 8.34E-07 2.00E-13 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 2.09E-06 1.51E-09 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 2.56E-07 NA mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 2.95E-10 1.62E-21 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 2.18E-11 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 3.16E-12 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 2.55E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 2.63E-06 6.48E-12 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 4.79E-13 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 3.24E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 7.70E-13 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 8.85E-08 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 1.10E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 8.16E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 2.57E-07 8.01E-11 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 3.68E-09 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 2.08E-08 3.14E-15 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 1.48E-08 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 2.69E-08 NA mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 4.72E-08 9.70E-07 mr1571 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 4.58E-06 NA mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 4.44E-07 1.80E-10 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 6.52E-09 8.07E-13 mr1695 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 7.36E-06 7.36E-06 mr1850 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 7.01E-07 NA mr1877 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 8.51E-07 4.25E-11 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 7.05E-11 2.22E-17 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 1.19E-06 NA mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 3.93E-08 1.37E-10 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 2.30E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 7.82E-09 8.27E-10 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 5.00E-09 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 2.29E-13 8.78E-25 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 1.09E-11 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 1.88E-06 4.60E-12 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 6.21E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 4.64E-06 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 1.34E-09 2.05E-13 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 8.88E-10 9.88E-18 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 2.16E-11 3.05E-19 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 8.60E-06 2.83E-09 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 1.89E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 2.41E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 4.88E-07 6.22E-17 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 1.66E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 2.50E-09 1.55E-18 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 1.14E-10 8.85E-15 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 1.39E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 8.10E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 3.29E-10 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 9.85E-06 NA mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 3.42E-13 NA mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 9.19E-08 NA mr1571_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 2.93E-07 2.93E-07 mr1571_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 4.32E-12 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 1.50E-09 3.21E-09 mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 1.48E-06 7.79E-14 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609857445 NA 7.91E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251