| Variant ID: vg0609822557 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9822557 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 250. )
TTACAGAAGATGTCCCTCTGCGAGCCTGATCCAACCACTATGTTTATGATTATCACCTTTCCTCCAGCATCTCTAGTAGGTATTGCATCTTTGCACCGTC[G/A,T]
AAGTATCTTGACACAATCGTCATCACCAAAACAATGCAAGACATACTGAAACATAAACATTTAGAAGTATAAAATAAAAGAAGTTTGGAGGCTAACTAGA
TCTAGTTAGCCTCCAAACTTCTTTTATTTTATACTTCTAAATGTTTATGTTTCAGTATGTCTTGCATTGTTTTGGTGATGACGATTGTGTCAAGATACTT[C/T,A]
GACGGTGCAAAGATGCAATACCTACTAGAGATGCTGGAGGAAAGGTGATAATCATAAACATAGTGGTTGGATCAGGCTCGCAGAGGGACATCTTCTGTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.80% | 27.50% | 0.63% | 0.00% | T: 0.06% |
| All Indica | 2759 | 79.20% | 20.20% | 0.62% | 0.00% | NA |
| All Japonica | 1512 | 60.60% | 38.50% | 0.66% | 0.00% | T: 0.20% |
| Aus | 269 | 82.90% | 16.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 95.80% | 3.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 74.20% | 24.90% | 0.86% | 0.00% | NA |
| Indica III | 913 | 70.10% | 29.10% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 80.00% | 19.50% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 71.20% | 28.30% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 56.30% | 43.10% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 36.10% | 61.40% | 1.24% | 0.00% | T: 1.24% |
| VI/Aromatic | 96 | 8.30% | 90.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 31.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609822557 | G -> T | LOC_Os06g16950.1 | synonymous_variant ; p.Arg74Arg; LOW | synonymous_codon | Average:28.699; most accessible tissue: Callus, score: 46.059 | N | N | N | N |
| vg0609822557 | G -> A | LOC_Os06g16950.1 | stop_gained ; p.Arg74*; HIGH | stop_gained | Average:28.699; most accessible tissue: Callus, score: 46.059 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609822557 | NA | 4.39E-06 | mr1057 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609822557 | 1.25E-06 | NA | mr1695 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609822557 | 3.26E-09 | NA | mr1695 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609822557 | 6.67E-06 | NA | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609822557 | 3.35E-07 | NA | mr1695_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |