\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609809561:

Variant ID: vg0609809561 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9809561
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TAATTTTTAACAAATGTCTTATTTACATAGTTTAAAATTCCTATTAATTTTTTAAAATCATATAATTGACAATTGGCTTTCTCACATATAGTTTAAAATT[C/T]
CTAACAATTTTTTAAAACCACATAATTAACAAATCCATTTCTTCAAAGAGTTTTAAATCGTAATTAACTGGAATGGCATGAAACATATGCAATTCATTCA

Reverse complement sequence

TGAATGAATTGCATATGTTTCATGCCATTCCAGTTAATTACGATTTAAAACTCTTTGAAGAAATGGATTTGTTAATTATGTGGTTTTAAAAAATTGTTAG[G/A]
AATTTTAAACTATATGTGAGAAAGCCAATTGTCAATTATATGATTTTAAAAAATTAATAGGAATTTTAAACTATGTAAATAAGACATTTGTTAAAAATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.40% 17.50% 0.13% 0.00% NA
All Indica  2759 79.40% 20.40% 0.14% 0.00% NA
All Japonica  1512 83.70% 16.30% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 84.70% 15.00% 0.34% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 70.80% 29.00% 0.22% 0.00% NA
Indica Intermediate  786 74.60% 25.40% 0.00% 0.00% NA
Temperate Japonica  767 94.80% 5.10% 0.13% 0.00% NA
Tropical Japonica  504 65.30% 34.70% 0.00% 0.00% NA
Japonica Intermediate  241 86.70% 13.30% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609809561 C -> T LOC_Os06g16919.2 upstream_gene_variant ; 438.0bp to feature; MODIFIER silent_mutation Average:21.296; most accessible tissue: Callus, score: 61.319 N N N N
vg0609809561 C -> T LOC_Os06g16930.1 upstream_gene_variant ; 4039.0bp to feature; MODIFIER silent_mutation Average:21.296; most accessible tissue: Callus, score: 61.319 N N N N
vg0609809561 C -> T LOC_Os06g16919.3 upstream_gene_variant ; 438.0bp to feature; MODIFIER silent_mutation Average:21.296; most accessible tissue: Callus, score: 61.319 N N N N
vg0609809561 C -> T LOC_Os06g16919.4 upstream_gene_variant ; 438.0bp to feature; MODIFIER silent_mutation Average:21.296; most accessible tissue: Callus, score: 61.319 N N N N
vg0609809561 C -> T LOC_Os06g16919.1 upstream_gene_variant ; 438.0bp to feature; MODIFIER silent_mutation Average:21.296; most accessible tissue: Callus, score: 61.319 N N N N
vg0609809561 C -> T LOC_Os06g16919-LOC_Os06g16930 intergenic_region ; MODIFIER silent_mutation Average:21.296; most accessible tissue: Callus, score: 61.319 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609809561 NA 3.89E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 1.06E-14 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 6.91E-08 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 2.42E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 5.72E-08 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 3.05E-10 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 7.53E-06 mr1111 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 3.66E-09 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 1.22E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 3.44E-06 mr1215 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 8.74E-07 2.41E-10 mr1218 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 1.67E-06 6.04E-09 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 4.94E-10 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 8.37E-08 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 1.49E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 2.14E-07 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 1.58E-12 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 2.26E-06 7.10E-17 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 2.71E-08 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 5.50E-08 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 6.90E-06 1.16E-09 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 5.09E-07 2.44E-14 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 7.47E-06 9.00E-13 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 4.52E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 7.68E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 1.80E-13 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 4.52E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 4.19E-06 4.16E-13 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 3.84E-06 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 2.72E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 1.22E-08 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 1.63E-07 NA mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 3.23E-09 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609809561 NA 2.57E-09 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251