\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609793222:

Variant ID: vg0609793222 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9793222
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTCGACAAAGGAGATGGTTAGAACTCATCAAGGATTATGATGTGGGAATTCACTATCATCCTGGCAAGGCTAACGTGGTTGCCGACGCTCTAAGTCGAA[A/G]
GAGCCATTGCAATACTCTCAACGTTCGTGGCATTCCACCCGAACTTAGTCAACAGATGGAAGCCCTGAACCTAAACATAGTTGGTCGTGGATTTTTGGCC

Reverse complement sequence

GGCCAAAAATCCACGACCAACTATGTTTAGGTTCAGGGCTTCCATCTGTTGACTAAGTTCGGGTGGAATGCCACGAACGTTGAGAGTATTGCAATGGCTC[T/C]
TTCGACTTAGAGCGTCGGCAACCACGTTAGCCTTGCCAGGATGATAGTGAATTCCCACATCATAATCCTTGATGAGTTCTAACCATCTCCTTTGTCGAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 5.70% 20.48% 15.81% NA
All Indica  2759 63.60% 0.70% 15.11% 20.51% NA
All Japonica  1512 45.00% 15.50% 31.94% 7.47% NA
Aus  269 79.20% 0.70% 9.67% 10.41% NA
Indica I  595 48.70% 1.30% 17.82% 32.10% NA
Indica II  465 60.90% 0.20% 13.55% 25.38% NA
Indica III  913 75.00% 0.50% 14.57% 9.86% NA
Indica Intermediate  786 63.40% 0.80% 14.63% 21.25% NA
Temperate Japonica  767 68.10% 3.00% 18.77% 10.17% NA
Tropical Japonica  504 16.50% 39.70% 42.06% 1.79% NA
Japonica Intermediate  241 31.50% 5.00% 52.70% 10.79% NA
VI/Aromatic  96 46.90% 0.00% 18.75% 34.38% NA
Intermediate  90 53.30% 12.20% 26.67% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609793222 A -> G LOC_Os06g16890.1 missense_variant ; p.Lys1257Arg; MODERATE nonsynonymous_codon ; K1257R Average:13.682; most accessible tissue: Minghui63 young leaf, score: 38.036 possibly damaging 1.541 DELETERIOUS 0.00
vg0609793222 A -> DEL LOC_Os06g16890.1 N frameshift_variant Average:13.682; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609793222 8.53E-06 NA mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609793222 1.51E-06 NA mr1362 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609793222 3.71E-06 3.71E-06 mr1362 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609793222 NA 1.76E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609793222 NA 1.20E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251