Search for Variation information by Variation ID:
Detailed information for vg0609793222:
| Variant ID: vg0609793222 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9793222 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CTTCGACAAAGGAGATGGTTAGAACTCATCAAGGATTATGATGTGGGAATTCACTATCATCCTGGCAAGGCTAACGTGGTTGCCGACGCTCTAAGTCGAA[A/G]
GAGCCATTGCAATACTCTCAACGTTCGTGGCATTCCACCCGAACTTAGTCAACAGATGGAAGCCCTGAACCTAAACATAGTTGGTCGTGGATTTTTGGCC
Reverse complement sequence
GGCCAAAAATCCACGACCAACTATGTTTAGGTTCAGGGCTTCCATCTGTTGACTAAGTTCGGGTGGAATGCCACGAACGTTGAGAGTATTGCAATGGCTC[T/C]
TTCGACTTAGAGCGTCGGCAACCACGTTAGCCTTGCCAGGATGATAGTGAATTCCCACATCATAATCCTTGATGAGTTCTAACCATCTCCTTTGTCGAAG
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 5.70% | 20.48% | 15.81% | NA |
| All Indica | 2759 | 63.60% | 0.70% | 15.11% | 20.51% | NA |
| All Japonica | 1512 | 45.00% | 15.50% | 31.94% | 7.47% | NA |
| Aus | 269 | 79.20% | 0.70% | 9.67% | 10.41% | NA |
| Indica I | 595 | 48.70% | 1.30% | 17.82% | 32.10% | NA |
| Indica II | 465 | 60.90% | 0.20% | 13.55% | 25.38% | NA |
| Indica III | 913 | 75.00% | 0.50% | 14.57% | 9.86% | NA |
| Indica Intermediate | 786 | 63.40% | 0.80% | 14.63% | 21.25% | NA |
| Temperate Japonica | 767 | 68.10% | 3.00% | 18.77% | 10.17% | NA |
| Tropical Japonica | 504 | 16.50% | 39.70% | 42.06% | 1.79% | NA |
| Japonica Intermediate | 241 | 31.50% | 5.00% | 52.70% | 10.79% | NA |
| VI/Aromatic | 96 | 46.90% | 0.00% | 18.75% | 34.38% | NA |
| Intermediate | 90 | 53.30% | 12.20% | 26.67% | 7.78% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609793222 | A -> G | LOC_Os06g16890.1 | missense_variant ; p.Lys1257Arg; MODERATE | nonsynonymous_codon ; K1257R | Average:13.682; most accessible tissue: Minghui63 young leaf, score: 38.036 | possibly damaging  |
1.541 |
DELETERIOUS | 0.00 |
| vg0609793222 | A -> DEL | LOC_Os06g16890.1 | N | frameshift_variant | Average:13.682; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609793222 | 8.53E-06 | NA | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609793222 | 1.51E-06 | NA | mr1362 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609793222 | 3.71E-06 | 3.71E-06 | mr1362 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609793222 | NA | 1.76E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609793222 | NA | 1.20E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |