Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609641742:

Variant ID: vg0609641742 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 9641742
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACTTTTAAAAATTATAATTATCACATATAACTAGCATATGCATGATTTAAAATTGTTAAACATTCTAATTAACATATGTAAATACCACATGCATGATTT[A/G]
AAATTAATAAAAATTATAATAATCATAAATAATTAGCATATGCATGATTTAAAATTGTTAAAAATTCTAATTAACATATGTAAATACCACATGCATGATT

Reverse complement sequence

AATCATGCATGTGGTATTTACATATGTTAATTAGAATTTTTAACAATTTTAAATCATGCATATGCTAATTATTTATGATTATTATAATTTTTATTAATTT[T/C]
AAATCATGCATGTGGTATTTACATATGTTAATTAGAATGTTTAACAATTTTAAATCATGCATATGCTAGTTATATGTGATAATTATAATTTTTAAAAGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.00%	3.20%	0.80%	0.00%	NA
All Indica	2759	99.30%	0.50%	0.22%	0.00%	NA
All Japonica	1512	89.40%	8.70%	1.92%	0.00%	NA
Aus	269	98.90%	0.00%	1.12%	0.00%	NA
Indica I	595	99.50%	0.00%	0.50%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	98.70%	1.20%	0.11%	0.00%	NA
Indica Intermediate	786	99.50%	0.40%	0.13%	0.00%	NA
Temperate Japonica	767	98.00%	0.00%	1.96%	0.00%	NA
Tropical Japonica	504	73.20%	25.40%	1.39%	0.00%	NA
Japonica Intermediate	241	95.90%	1.20%	2.90%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609641742	A -> G	LOC_Os06g16710.1	upstream_gene_variant ; 1210.0bp to feature; MODIFIER	silent_mutation	Average:14.922; most accessible tissue: Zhenshan97 flag leaf, score: 21.748	N	N	N	N
vg0609641742	A -> G	LOC_Os06g16720.1	downstream_gene_variant ; 3822.0bp to feature; MODIFIER	silent_mutation	Average:14.922; most accessible tissue: Zhenshan97 flag leaf, score: 21.748	N	N	N	N
vg0609641742	A -> G	LOC_Os06g16710-LOC_Os06g16720	intergenic_region ; MODIFIER	silent_mutation	Average:14.922; most accessible tissue: Zhenshan97 flag leaf, score: 21.748	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0609641742	NA	4.58E-07	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609641742	NA	9.46E-07	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609641742	5.63E-06	5.63E-06	mr1501	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609641742	5.27E-06	2.06E-10	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609641742	NA	9.55E-06	mr1638	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609641742	8.03E-06	8.03E-06	mr1929	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609641742	4.04E-08	2.11E-11	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251