Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609611196:

Variant ID: vg0609611196 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9611196
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTGAAATCTGTCAAACATAATTATGAATTCTTATAGTTGATGTTAACATGACATTTATATATTTACCATGTTATATATGTCACATTTATGTTAACTTCT[A/G]
TTATTGTATAGTAATTAGCTCAATTATTGCTGATCTTCAATTCTACATGCTACGAAGCAACATCTAGACATGCTAAATGTGCATGCAATGAAATATTTAA

Reverse complement sequence

TTAAATATTTCATTGCATGCACATTTAGCATGTCTAGATGTTGCTTCGTAGCATGTAGAATTGAAGATCAGCAATAATTGAGCTAATTACTATACAATAA[T/C]
AGAAGTTAACATAAATGTGACATATATAACATGGTAAATATATAAATGTCATGTTAACATCAACTATAAGAATTCATAATTATGTTTGACAGATTTCAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.60% 0.60% 0.85% 0.00% NA
All Indica  2759 99.90% 0.00% 0.11% 0.00% NA
All Japonica  1512 95.80% 1.90% 2.38% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 93.90% 2.60% 3.52% 0.00% NA
Tropical Japonica  504 99.00% 0.40% 0.60% 0.00% NA
Japonica Intermediate  241 95.00% 2.50% 2.49% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609611196 A -> G LOC_Os06g16680.1 intron_variant ; MODIFIER silent_mutation Average:54.491; most accessible tissue: Zhenshan97 flower, score: 70.106 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609611196 NA 1.73E-13 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0609611196 NA 1.05E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609611196 9.50E-06 8.01E-10 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609611196 NA 7.66E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609611196 1.81E-06 1.22E-10 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609611196 NA 2.18E-06 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609611196 NA 3.38E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609611196 3.04E-06 4.76E-10 mr1757_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251