RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0609611196:

Variant ID: vg0609611196 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 9611196
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTGAAATCTGTCAAACATAATTATGAATTCTTATAGTTGATGTTAACATGACATTTATATATTTACCATGTTATATATGTCACATTTATGTTAACTTCT[A/G]
TTATTGTATAGTAATTAGCTCAATTATTGCTGATCTTCAATTCTACATGCTACGAAGCAACATCTAGACATGCTAAATGTGCATGCAATGAAATATTTAA

Reverse complement sequence

TTAAATATTTCATTGCATGCACATTTAGCATGTCTAGATGTTGCTTCGTAGCATGTAGAATTGAAGATCAGCAATAATTGAGCTAATTACTATACAATAA[T/C]
AGAAGTTAACATAAATGTGACATATATAACATGGTAAATATATAAATGTCATGTTAACATCAACTATAAGAATTCATAATTATGTTTGACAGATTTCAAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.60%	0.60%	0.85%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.11%	0.00%	NA
All Japonica	1512	95.80%	1.90%	2.38%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	93.90%	2.60%	3.52%	0.00%	NA
Tropical Japonica	504	99.00%	0.40%	0.60%	0.00%	NA
Japonica Intermediate	241	95.00%	2.50%	2.49%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609611196	A -> G	LOC_Os06g16680.1	intron_variant ; MODIFIER	silent_mutation	Average:54.491; most accessible tissue: Zhenshan97 flower, score: 70.106	N	N	N	N

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0609611196	NA	1.73E-13	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0609611196	NA	1.05E-06	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609611196	9.50E-06	8.01E-10	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609611196	NA	7.66E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609611196	1.81E-06	1.22E-10	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609611196	NA	2.18E-06	mr1550_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609611196	NA	3.38E-06	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609611196	3.04E-06	4.76E-10	mr1757_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 8 of 8 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0609611196:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact