\
| Variant ID: vg0609609548 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9609548 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 93. )
TATGAAGACAAGATTATTGCTAACATTGCAGTTGTTGCTGGTTGCTCGCTGGACGTTGGCTTCTGCGGCGGCAGCGCGTGGTCTGCATTGAGAAGGAAGG[C/T]
GTATGGCAGCGGGTGGCGCCAAGCACAAACTTCTACCCTAACCCTAGCTGTCCCGGCACAAAAACAGACCCTGCTGGCACGGGCATGGTCCGTCACCAAG
CTTGGTGACGGACCATGCCCGTGCCAGCAGGGTCTGTTTTTGTGCCGGGACAGCTAGGGTTAGGGTAGAAGTTTGTGCTTGGCGCCACCCGCTGCCATAC[G/A]
CCTTCCTTCTCAATGCAGACCACGCGCTGCCGCCGCAGAAGCCAACGTCCAGCGAGCAACCAGCAACAACTGCAATGTTAGCAATAATCTTGTCTTCATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.40% | 48.30% | 0.66% | 0.61% | NA |
| All Indica | 2759 | 18.20% | 80.80% | 0.87% | 0.18% | NA |
| All Japonica | 1512 | 98.20% | 1.40% | 0.33% | 0.07% | NA |
| Aus | 269 | 91.10% | 0.40% | 0.37% | 8.18% | NA |
| Indica I | 595 | 16.30% | 83.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 17.20% | 82.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 19.30% | 78.60% | 1.86% | 0.22% | NA |
| Indica Intermediate | 786 | 19.00% | 80.00% | 0.64% | 0.38% | NA |
| Temperate Japonica | 767 | 98.30% | 1.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.70% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 62.20% | 36.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609609548 | C -> T | LOC_Os06g16680.1 | missense_variant ; p.Ala42Val; MODERATE | nonsynonymous_codon ; A42V | Average:73.037; most accessible tissue: Callus, score: 89.248 | unknown | unknown | DELETERIOUS | 0.00 |
| vg0609609548 | C -> DEL | LOC_Os06g16680.1 | N | frameshift_variant | Average:73.037; most accessible tissue: Callus, score: 89.248 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609609548 | NA | 4.82E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 2.22E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | 2.01E-07 | NA | mr1090 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | 6.37E-08 | 4.24E-13 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | 9.08E-06 | NA | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 7.73E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | 3.08E-08 | NA | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | 1.42E-08 | 5.97E-16 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 3.64E-33 | mr1221 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 1.30E-06 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 3.97E-17 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 7.41E-07 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 6.16E-07 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 9.83E-09 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 5.17E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 3.32E-09 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 3.51E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | 9.18E-06 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | 2.11E-06 | NA | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | 2.25E-08 | 9.19E-13 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 8.75E-07 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 2.07E-12 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | 3.44E-07 | NA | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | 9.08E-10 | 9.93E-17 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 5.18E-41 | mr1221_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 4.80E-09 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | 5.32E-06 | NA | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 3.26E-15 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 2.44E-07 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 8.53E-12 | mr1734_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 1.06E-11 | mr1782_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 8.66E-09 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 4.70E-11 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609609548 | NA | 5.23E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |