Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609585936:

Variant ID: vg0609585936 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 9585936
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGAAAAATGTCTCTACAAGACCAAATGGCACTTATGAGACACTCTTCAAAATGTCTCTATAATATTGTAAAGGCATTTTAAAAATGTCTCTATAGTATT[A/C]
TAAGTAACCTATACTTGCAAAATTCGTAGTAAATTCATCCTAGTTATATAAAAATTCTAACTCGACTTGGTTGAAATTAGTGGAACACCCTCTTTACTGC

Reverse complement sequence

GCAGTAAAGAGGGTGTTCCACTAATTTCAACCAAGTCGAGTTAGAATTTTTATATAACTAGGATGAATTTACTACGAATTTTGCAAGTATAGGTTACTTA[T/G]
AATACTATAGAGACATTTTTAAAATGCCTTTACAATATTATAGAGACATTTTGAAGAGTGTCTCATAAGTGCCATTTGGTCTTGTAGAGACATTTTTCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.90%	0.90%	3.55%	36.63%	NA
All Indica	2759	82.70%	0.50%	2.79%	13.95%	NA
All Japonica	1512	29.60%	1.30%	2.25%	66.93%	NA
Aus	269	1.90%	1.90%	19.33%	76.95%	NA
Indica I	595	85.50%	0.20%	0.34%	13.95%	NA
Indica II	465	83.40%	0.60%	2.80%	13.12%	NA
Indica III	913	81.70%	0.80%	3.94%	13.58%	NA
Indica Intermediate	786	81.30%	0.50%	3.31%	14.89%	NA
Temperate Japonica	767	53.10%	0.50%	0.91%	45.50%	NA
Tropical Japonica	504	2.60%	2.40%	3.97%	91.07%	NA
Japonica Intermediate	241	11.20%	1.20%	2.90%	84.65%	NA
VI/Aromatic	96	4.20%	4.20%	2.08%	89.58%	NA
Intermediate	90	50.00%	1.10%	3.33%	45.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609585936	A -> C	LOC_Os06g16660.1	upstream_gene_variant ; 3848.0bp to feature; MODIFIER	silent_mutation	Average:22.205; most accessible tissue: Callus, score: 39.434	N	N	N	N
vg0609585936	A -> C	LOC_Os06g16640-LOC_Os06g16660	intergenic_region ; MODIFIER	silent_mutation	Average:22.205; most accessible tissue: Callus, score: 39.434	N	N	N	N
vg0609585936	A -> DEL	N	N	silent_mutation	Average:22.205; most accessible tissue: Callus, score: 39.434	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0609585936	9.90E-06	NA	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	1.47E-08	5.96E-14	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	7.31E-06	NA	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	9.63E-06	NA	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	2.33E-09	5.98E-17	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	NA	9.55E-07	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	NA	1.05E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	2.27E-06	NA	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	4.39E-09	1.48E-13	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	6.24E-06	NA	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	7.27E-06	2.89E-07	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	NA	7.58E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	5.05E-06	NA	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	NA	7.65E-07	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	NA	4.33E-14	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	2.30E-07	NA	mr1211_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	6.38E-11	6.73E-18	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	NA	6.58E-11	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	NA	5.00E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	NA	1.11E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	NA	5.62E-11	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	NA	3.61E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936	NA	5.97E-09	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251