\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609585936:

Variant ID: vg0609585936 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9585936
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGAAAAATGTCTCTACAAGACCAAATGGCACTTATGAGACACTCTTCAAAATGTCTCTATAATATTGTAAAGGCATTTTAAAAATGTCTCTATAGTATT[A/C]
TAAGTAACCTATACTTGCAAAATTCGTAGTAAATTCATCCTAGTTATATAAAAATTCTAACTCGACTTGGTTGAAATTAGTGGAACACCCTCTTTACTGC

Reverse complement sequence

GCAGTAAAGAGGGTGTTCCACTAATTTCAACCAAGTCGAGTTAGAATTTTTATATAACTAGGATGAATTTACTACGAATTTTGCAAGTATAGGTTACTTA[T/G]
AATACTATAGAGACATTTTTAAAATGCCTTTACAATATTATAGAGACATTTTGAAGAGTGTCTCATAAGTGCCATTTGGTCTTGTAGAGACATTTTTCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 0.90% 3.55% 36.63% NA
All Indica  2759 82.70% 0.50% 2.79% 13.95% NA
All Japonica  1512 29.60% 1.30% 2.25% 66.93% NA
Aus  269 1.90% 1.90% 19.33% 76.95% NA
Indica I  595 85.50% 0.20% 0.34% 13.95% NA
Indica II  465 83.40% 0.60% 2.80% 13.12% NA
Indica III  913 81.70% 0.80% 3.94% 13.58% NA
Indica Intermediate  786 81.30% 0.50% 3.31% 14.89% NA
Temperate Japonica  767 53.10% 0.50% 0.91% 45.50% NA
Tropical Japonica  504 2.60% 2.40% 3.97% 91.07% NA
Japonica Intermediate  241 11.20% 1.20% 2.90% 84.65% NA
VI/Aromatic  96 4.20% 4.20% 2.08% 89.58% NA
Intermediate  90 50.00% 1.10% 3.33% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609585936 A -> C LOC_Os06g16660.1 upstream_gene_variant ; 3848.0bp to feature; MODIFIER silent_mutation Average:22.205; most accessible tissue: Callus, score: 39.434 N N N N
vg0609585936 A -> C LOC_Os06g16640-LOC_Os06g16660 intergenic_region ; MODIFIER silent_mutation Average:22.205; most accessible tissue: Callus, score: 39.434 N N N N
vg0609585936 A -> DEL N N silent_mutation Average:22.205; most accessible tissue: Callus, score: 39.434 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609585936 9.90E-06 NA mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 1.47E-08 5.96E-14 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 7.31E-06 NA mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 9.63E-06 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 2.33E-09 5.98E-17 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 NA 9.55E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 NA 1.05E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 2.27E-06 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 4.39E-09 1.48E-13 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 6.24E-06 NA mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 7.27E-06 2.89E-07 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 NA 7.58E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 5.05E-06 NA mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 NA 7.65E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 NA 4.33E-14 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 2.30E-07 NA mr1211_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 6.38E-11 6.73E-18 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 NA 6.58E-11 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 NA 5.00E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 NA 1.11E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 NA 5.62E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 NA 3.61E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609585936 NA 5.97E-09 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251