| Variant ID: vg0609471975 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9471975 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAGCCATCAGTGATGACATCCACCTCTGACGGGCAAGTAAATAGAAGGCCGTCAGAGGTGTTGGTCTCAGCTAGCCTAGGGCCAGTTAGTACCTGTCACA[T/G]
GTGTCTCATCTCTGACGGACCCCTAAATAAAAGCTCGTCAGAGGTGACGGTCTCCGGTATATAGTAGCCGTCACAGGTGACCCACCTGTGACGGGCTCGA
TCGAGCCCGTCACAGGTGGGTCACCTGTGACGGCTACTATATACCGGAGACCGTCACCTCTGACGAGCTTTTATTTAGGGGTCCGTCAGAGATGAGACAC[A/C]
TGTGACAGGTACTAACTGGCCCTAGGCTAGCTGAGACCAACACCTCTGACGGCCTTCTATTTACTTGCCCGTCAGAGGTGGATGTCATCACTGATGGCTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.80% | 0.10% | 9.94% | 32.18% | NA |
| All Indica | 2759 | 78.50% | 0.20% | 11.78% | 9.53% | NA |
| All Japonica | 1512 | 32.90% | 0.00% | 7.94% | 59.19% | NA |
| Aus | 269 | 5.20% | 0.00% | 4.46% | 90.33% | NA |
| Indica I | 595 | 84.70% | 0.00% | 4.03% | 11.26% | NA |
| Indica II | 465 | 83.90% | 0.00% | 4.73% | 11.40% | NA |
| Indica III | 913 | 71.40% | 0.40% | 21.47% | 6.68% | NA |
| Indica Intermediate | 786 | 78.90% | 0.10% | 10.56% | 10.43% | NA |
| Temperate Japonica | 767 | 57.50% | 0.00% | 0.91% | 41.59% | NA |
| Tropical Japonica | 504 | 5.40% | 0.00% | 19.05% | 75.60% | NA |
| Japonica Intermediate | 241 | 12.00% | 0.00% | 7.05% | 80.91% | NA |
| VI/Aromatic | 96 | 7.30% | 0.00% | 2.08% | 90.62% | NA |
| Intermediate | 90 | 51.10% | 0.00% | 12.22% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609471975 | T -> G | LOC_Os06g16500.1 | upstream_gene_variant ; 3982.0bp to feature; MODIFIER | silent_mutation | Average:64.472; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0609471975 | T -> G | LOC_Os06g16510.1 | downstream_gene_variant ; 897.0bp to feature; MODIFIER | silent_mutation | Average:64.472; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0609471975 | T -> G | LOC_Os06g16500-LOC_Os06g16510 | intergenic_region ; MODIFIER | silent_mutation | Average:64.472; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0609471975 | T -> DEL | N | N | silent_mutation | Average:64.472; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609471975 | 5.91E-06 | 2.13E-11 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609471975 | 5.91E-06 | 1.92E-13 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609471975 | NA | 2.94E-07 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609471975 | 6.74E-06 | NA | mr1679 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609471975 | NA | 4.23E-12 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609471975 | 7.64E-07 | 3.85E-11 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609471975 | NA | 8.67E-06 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609471975 | NA | 1.11E-15 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609471975 | 7.32E-07 | 5.84E-14 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609471975 | NA | 1.25E-08 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/