Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0609471975:

Variant ID: vg0609471975 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 9471975
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGCCATCAGTGATGACATCCACCTCTGACGGGCAAGTAAATAGAAGGCCGTCAGAGGTGTTGGTCTCAGCTAGCCTAGGGCCAGTTAGTACCTGTCACA[T/G]
GTGTCTCATCTCTGACGGACCCCTAAATAAAAGCTCGTCAGAGGTGACGGTCTCCGGTATATAGTAGCCGTCACAGGTGACCCACCTGTGACGGGCTCGA

Reverse complement sequence

TCGAGCCCGTCACAGGTGGGTCACCTGTGACGGCTACTATATACCGGAGACCGTCACCTCTGACGAGCTTTTATTTAGGGGTCCGTCAGAGATGAGACAC[A/C]
TGTGACAGGTACTAACTGGCCCTAGGCTAGCTGAGACCAACACCTCTGACGGCCTTCTATTTACTTGCCCGTCAGAGGTGGATGTCATCACTGATGGCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.80%	0.10%	9.94%	32.18%	NA
All Indica	2759	78.50%	0.20%	11.78%	9.53%	NA
All Japonica	1512	32.90%	0.00%	7.94%	59.19%	NA
Aus	269	5.20%	0.00%	4.46%	90.33%	NA
Indica I	595	84.70%	0.00%	4.03%	11.26%	NA
Indica II	465	83.90%	0.00%	4.73%	11.40%	NA
Indica III	913	71.40%	0.40%	21.47%	6.68%	NA
Indica Intermediate	786	78.90%	0.10%	10.56%	10.43%	NA
Temperate Japonica	767	57.50%	0.00%	0.91%	41.59%	NA
Tropical Japonica	504	5.40%	0.00%	19.05%	75.60%	NA
Japonica Intermediate	241	12.00%	0.00%	7.05%	80.91%	NA
VI/Aromatic	96	7.30%	0.00%	2.08%	90.62%	NA
Intermediate	90	51.10%	0.00%	12.22%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609471975	T -> G	LOC_Os06g16500.1	upstream_gene_variant ; 3982.0bp to feature; MODIFIER	silent_mutation	Average:64.472; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0609471975	T -> G	LOC_Os06g16510.1	downstream_gene_variant ; 897.0bp to feature; MODIFIER	silent_mutation	Average:64.472; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0609471975	T -> G	LOC_Os06g16500-LOC_Os06g16510	intergenic_region ; MODIFIER	silent_mutation	Average:64.472; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0609471975	T -> DEL	N	N	silent_mutation	Average:64.472; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0609471975	5.91E-06	2.13E-11	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	5.91E-06	1.92E-13	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	NA	2.94E-07	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	6.74E-06	NA	mr1679	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	NA	4.23E-12	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	7.64E-07	3.85E-11	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	NA	8.67E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	NA	1.11E-15	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	7.32E-07	5.84E-14	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	NA	1.25E-08	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	NA	4.52E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	NA	9.35E-15	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	NA	9.69E-10	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	NA	3.30E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	NA	4.13E-09	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	NA	7.83E-13	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	NA	1.98E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975	NA	1.15E-08	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251