\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609471975:

Variant ID: vg0609471975 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9471975
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCCATCAGTGATGACATCCACCTCTGACGGGCAAGTAAATAGAAGGCCGTCAGAGGTGTTGGTCTCAGCTAGCCTAGGGCCAGTTAGTACCTGTCACA[T/G]
GTGTCTCATCTCTGACGGACCCCTAAATAAAAGCTCGTCAGAGGTGACGGTCTCCGGTATATAGTAGCCGTCACAGGTGACCCACCTGTGACGGGCTCGA

Reverse complement sequence

TCGAGCCCGTCACAGGTGGGTCACCTGTGACGGCTACTATATACCGGAGACCGTCACCTCTGACGAGCTTTTATTTAGGGGTCCGTCAGAGATGAGACAC[A/C]
TGTGACAGGTACTAACTGGCCCTAGGCTAGCTGAGACCAACACCTCTGACGGCCTTCTATTTACTTGCCCGTCAGAGGTGGATGTCATCACTGATGGCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 0.10% 9.94% 32.18% NA
All Indica  2759 78.50% 0.20% 11.78% 9.53% NA
All Japonica  1512 32.90% 0.00% 7.94% 59.19% NA
Aus  269 5.20% 0.00% 4.46% 90.33% NA
Indica I  595 84.70% 0.00% 4.03% 11.26% NA
Indica II  465 83.90% 0.00% 4.73% 11.40% NA
Indica III  913 71.40% 0.40% 21.47% 6.68% NA
Indica Intermediate  786 78.90% 0.10% 10.56% 10.43% NA
Temperate Japonica  767 57.50% 0.00% 0.91% 41.59% NA
Tropical Japonica  504 5.40% 0.00% 19.05% 75.60% NA
Japonica Intermediate  241 12.00% 0.00% 7.05% 80.91% NA
VI/Aromatic  96 7.30% 0.00% 2.08% 90.62% NA
Intermediate  90 51.10% 0.00% 12.22% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609471975 T -> G LOC_Os06g16500.1 upstream_gene_variant ; 3982.0bp to feature; MODIFIER silent_mutation Average:64.472; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0609471975 T -> G LOC_Os06g16510.1 downstream_gene_variant ; 897.0bp to feature; MODIFIER silent_mutation Average:64.472; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0609471975 T -> G LOC_Os06g16500-LOC_Os06g16510 intergenic_region ; MODIFIER silent_mutation Average:64.472; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0609471975 T -> DEL N N silent_mutation Average:64.472; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609471975 5.91E-06 2.13E-11 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 5.91E-06 1.92E-13 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 NA 2.94E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 6.74E-06 NA mr1679 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 NA 4.23E-12 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 7.64E-07 3.85E-11 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 NA 8.67E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 NA 1.11E-15 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 7.32E-07 5.84E-14 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 NA 1.25E-08 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 NA 4.52E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 NA 9.35E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 NA 9.69E-10 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 NA 3.30E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 NA 4.13E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 NA 7.83E-13 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 NA 1.98E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609471975 NA 1.15E-08 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251