\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609394624:

Variant ID: vg0609394624 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9394624
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, C: 0.43, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTACGTTATATGTAATATGAGAGAGTATGAGCCTCTGTGGCACGAATTGAGATCCTCTGCCTTTAAATACATCATGCCTTTTATTACTGACACGTGAT[C/T]
CCATATAGTTTATCGGTTTCACATGCCAATGACAAACACATTTTGAAGGTAGTGGAGCCTGATCCCCGTGGCACCCCTCTGGCATCATGCCAAACTTGCC

Reverse complement sequence

GGCAAGTTTGGCATGATGCCAGAGGGGTGCCACGGGGATCAGGCTCCACTACCTTCAAAATGTGTTTGTCATTGGCATGTGAAACCGATAAACTATATGG[G/A]
ATCACGTGTCAGTAATAAAAGGCATGATGTATTTAAAGGCAGAGGATCTCAATTCGTGCCACAGAGGCTCATACTCTCTCATATTACATATAACGTAGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.70% 47.80% 0.00% 0.53% NA
All Indica  2759 19.50% 79.80% 0.00% 0.65% NA
All Japonica  1512 98.50% 1.20% 0.00% 0.33% NA
Aus  269 98.50% 1.10% 0.00% 0.37% NA
Indica I  595 14.60% 85.40% 0.00% 0.00% NA
Indica II  465 16.80% 81.70% 0.00% 1.51% NA
Indica III  913 25.10% 74.60% 0.00% 0.33% NA
Indica Intermediate  786 18.30% 80.70% 0.00% 1.02% NA
Temperate Japonica  767 98.70% 1.00% 0.00% 0.26% NA
Tropical Japonica  504 98.60% 1.00% 0.00% 0.40% NA
Japonica Intermediate  241 97.50% 2.10% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609394624 C -> T LOC_Os06g16420.1 upstream_gene_variant ; 1506.0bp to feature; MODIFIER silent_mutation Average:99.14; most accessible tissue: Minghui63 young leaf, score: 99.722 N N N N
vg0609394624 C -> T LOC_Os06g16420.2 upstream_gene_variant ; 1506.0bp to feature; MODIFIER silent_mutation Average:99.14; most accessible tissue: Minghui63 young leaf, score: 99.722 N N N N
vg0609394624 C -> T LOC_Os06g16420.3 upstream_gene_variant ; 1525.0bp to feature; MODIFIER silent_mutation Average:99.14; most accessible tissue: Minghui63 young leaf, score: 99.722 N N N N
vg0609394624 C -> T LOC_Os06g16410-LOC_Os06g16420 intergenic_region ; MODIFIER silent_mutation Average:99.14; most accessible tissue: Minghui63 young leaf, score: 99.722 N N N N
vg0609394624 C -> DEL N N silent_mutation Average:99.14; most accessible tissue: Minghui63 young leaf, score: 99.722 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0609394624 C T -0.02 0.0 0.0 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609394624 NA 4.78E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 1.20E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 1.86E-06 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 1.81E-07 1.06E-12 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 4.02E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 9.00E-07 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 1.37E-07 4.57E-15 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 2.41E-31 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 2.57E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 7.32E-17 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 8.08E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 6.30E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 7.40E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 1.51E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 2.16E-09 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 2.24E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 5.85E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 1.05E-06 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 7.80E-08 3.52E-12 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 2.39E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 2.27E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 2.00E-06 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 8.20E-09 9.97E-16 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 1.37E-38 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 5.08E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 8.37E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 3.39E-13 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 7.95E-13 mr1782_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609394624 NA 1.69E-09 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251